ID: 972451671

View in Genome Browser
Species Human (GRCh38)
Location 4:39206377-39206399
Sequence GGCACCTAAAACTCTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972451667_972451671 -10 Left 972451667 4:39206364-39206386 CCAAGGACCCACAGGCACCTAAA 0: 1
1: 0
2: 0
3: 15
4: 173
Right 972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG 0: 1
1: 1
2: 2
3: 11
4: 93
972451661_972451671 21 Left 972451661 4:39206333-39206355 CCCCATGGCAGTGGCAACAAGAA 0: 1
1: 0
2: 1
3: 22
4: 186
Right 972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG 0: 1
1: 1
2: 2
3: 11
4: 93
972451662_972451671 20 Left 972451662 4:39206334-39206356 CCCATGGCAGTGGCAACAAGAAC 0: 1
1: 0
2: 2
3: 45
4: 732
Right 972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG 0: 1
1: 1
2: 2
3: 11
4: 93
972451663_972451671 19 Left 972451663 4:39206335-39206357 CCATGGCAGTGGCAACAAGAACA 0: 1
1: 0
2: 1
3: 23
4: 219
Right 972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG 0: 1
1: 1
2: 2
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972451671 Original CRISPR GGCACCTAAAACTCTGATGG AGG Intronic
911070886 1:93831031-93831053 TGGACCCAAAACTCTGGTGGCGG + Intronic
911443767 1:97964525-97964547 GGCTCCTAAATCTGTGATGATGG - Intergenic
916075525 1:161198104-161198126 GGCACCCCTAACTCTGCTGGGGG - Exonic
916647258 1:166797877-166797899 GGCTCCTTAAAATCTGATGAGGG - Intergenic
916785896 1:168086873-168086895 TGAACCTAAAACTCTGACAGAGG + Intronic
916817857 1:168371063-168371085 GGCAGCCAAAACTCTGAGGAAGG + Intergenic
1067919552 10:50439567-50439589 GGCATCAAAAATTCTGTTGGGGG + Intronic
1068351428 10:55850619-55850641 GGCACCTAGAAATCTAATGTTGG - Intergenic
1070739244 10:78891845-78891867 GGAATCAAAAACTCTGAAGGTGG - Intergenic
1072649224 10:97280881-97280903 GGCACTTAAAAGTCTGTAGGAGG - Intronic
1084267492 11:68012482-68012504 TGCACCTCAACCTGTGATGGGGG + Intronic
1084695357 11:70750376-70750398 GGCACCTAAAACTCTGGAGGAGG + Intronic
1095897940 12:47299641-47299663 GGGGCCTAAAACTCTGAAGAAGG - Intergenic
1097584353 12:61497659-61497681 TGCACCTAGAATTCTGATTGAGG - Intergenic
1098572219 12:72001158-72001180 ATCACCTAAAACTCTTGTGGAGG - Intronic
1106343468 13:28853399-28853421 GGCTCCTAAAATTCTGCTGGGGG + Intronic
1116292312 14:43059609-43059631 GTCAGCTCAAACACTGATGGTGG + Intergenic
1117528173 14:56632376-56632398 GGCACCCAAAACTCTGAGAGAGG - Intronic
1119095864 14:71830170-71830192 AACACCTAAAACTCTGAGAGAGG + Intergenic
1124683909 15:31762245-31762267 TGTTCCTAAAACTCTGAGGGAGG + Intronic
1124832170 15:33159835-33159857 GGCACCTAAAACTCTGAGGGAGG + Intronic
1125074427 15:35596641-35596663 GGTACCTAAAACACTGTTGAAGG - Intergenic
1126800357 15:52292522-52292544 GGCACATGAAACTCTGAGGATGG + Intronic
1127564297 15:60171490-60171512 GGCCCTTACAACTCTGTTGGAGG - Intergenic
1132519211 16:379667-379689 GGCACCTAGAACCCAGCTGGTGG + Intronic
1135585600 16:23668599-23668621 GGCAGCCAAAACTCTGAGGAAGG + Exonic
1136595865 16:31249402-31249424 GGCACATAAAACTTTTCTGGAGG + Intergenic
1138317100 16:56079547-56079569 GTCACCTACTACTCTGCTGGAGG + Intergenic
1138917612 16:61486072-61486094 GAGACCTAAAACTCTGGTTGAGG - Intergenic
1142150645 16:88511159-88511181 GGCACCGACAGCTCTGAGGGCGG - Intronic
1142350754 16:89578457-89578479 AGCACCTAAAAGTCTCCTGGTGG + Intronic
1146647133 17:34582881-34582903 GTCACCTCAAACGCTGATGATGG + Intronic
1148694946 17:49553152-49553174 GGCACCCAGGACTCTCATGGAGG - Intergenic
1149116518 17:53103636-53103658 TGCAACTAAAACTCAGATGGTGG - Intergenic
1149275033 17:55024457-55024479 GGCAGCAAAACTTCTGATGGTGG + Intronic
1155636939 18:27967208-27967230 GGGACATAAAAATCTGATGATGG + Intronic
1165292637 19:34900488-34900510 GGAACCTCAAACACTGTTGGTGG + Intergenic
1165749672 19:38252249-38252271 GGCCCCAAGTACTCTGATGGGGG - Intronic
1166080518 19:40441476-40441498 GGGTCCTAAAACTGTGATAGAGG - Exonic
1168387466 19:55976532-55976554 GGAACCAGAAACTCTGAGGGTGG + Intronic
926703147 2:15817482-15817504 GGCACCTGAAGCTCTGAGGCTGG - Intergenic
929021316 2:37556115-37556137 GGCACCTGAAACTGTGAAGAAGG - Intergenic
929985519 2:46728013-46728035 GGTACCTAAAACTCTGAGGGAGG - Intronic
931655191 2:64504581-64504603 GGCACCTGAAGCTCTGACTGAGG - Intergenic
932144288 2:69305193-69305215 GGCAGCTACAACTCTGCGGGGGG + Intergenic
938633595 2:133196914-133196936 ATCACCTAAAGCTCTGAAGGAGG + Intronic
939887261 2:147694592-147694614 GACACCTAACACTCTGATTTTGG + Intergenic
940835771 2:158519824-158519846 TGTAATTAAAACTCTGATGGAGG - Intronic
940927931 2:159388713-159388735 GCCACCTAAAGCACTGAAGGAGG + Intronic
943944552 2:194043108-194043130 GGGAGCCAAAACTCTGATAGGGG + Intergenic
944336601 2:198542019-198542041 GGCAGCTGAGACTCTGTTGGGGG - Intronic
947572295 2:231245713-231245735 GCCACCTAAATGTCTGATAGAGG - Intronic
1168886535 20:1263330-1263352 GGTGCCTAAAACTCTGAGGGAGG - Intronic
1178278559 21:31261202-31261224 GTCACCTAAAACACTGATTACGG - Intronic
950991414 3:17442321-17442343 GGCACCTAAAACTCTTAATAAGG + Intronic
953836311 3:46348813-46348835 GGACCATAAACCTCTGATGGTGG - Intergenic
955033625 3:55244723-55244745 GGGACTTAAAATTCTAATGGTGG + Intergenic
957169528 3:76720109-76720131 GGCACCAATAACACTGATGAGGG - Intronic
958489577 3:94754534-94754556 TCCACCTGAAACTCTAATGGAGG + Intergenic
963495368 3:146052959-146052981 GGTACCGAAAACTCTGAGAGAGG + Intergenic
964842430 3:161008477-161008499 GTCACATAAAACTATGATCGAGG + Intronic
969193245 4:5541077-5541099 GTCACCTAACACTCTGCTGTCGG - Intergenic
972451671 4:39206377-39206399 GGCACCTAAAACTCTGATGGAGG + Intronic
973755669 4:54070949-54070971 GGCACCAAAAACTCTAAGGTTGG - Intronic
974104373 4:57452628-57452650 AACACCTAAAACTGTAATGGTGG - Intergenic
975855157 4:78616807-78616829 GGCACCTAGAACTCAAATGAAGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976087811 4:81424168-81424190 AGCAACTAAAATTCTAATGGTGG + Intergenic
977404967 4:96585948-96585970 GGCAAATAAAACCCTGATGGGGG - Intergenic
985920401 5:2966795-2966817 GGCCTCTACAAGTCTGATGGGGG + Intergenic
986493492 5:8317909-8317931 GGAGCGTAATACTCTGATGGGGG - Intergenic
987556770 5:19462120-19462142 GGCAATTAACACTCTGAAGGAGG + Intergenic
991396961 5:66214135-66214157 GACACCTAAAACTGTTAGGGAGG - Intergenic
992685334 5:79194127-79194149 GGCATCAGAAACTCTGAAGGTGG + Intronic
994639531 5:102389501-102389523 AGAACTAAAAACTCTGATGGTGG + Intronic
1000402252 5:160842320-160842342 TGCACCTAAAGCTATGATTGGGG + Intronic
1002071948 5:176684160-176684182 GGAACCTAAAACTCTAAGGAAGG + Intergenic
1002448341 5:179303698-179303720 GGCACCTAAAACTCTAAGAGGGG + Intronic
1002610320 5:180413534-180413556 GGTACCTGAAACTCTGAGGGAGG + Intergenic
1006262793 6:32890281-32890303 GGGAACTCATACTCTGATGGTGG - Intergenic
1008552981 6:52650924-52650946 GGCACCTAAAACTCAGGGAGAGG + Intergenic
1008943833 6:57075502-57075524 TAAACCTAAAACACTGATGGTGG - Intergenic
1013439891 6:110153263-110153285 TTCACCTAGAACTCTGTTGGTGG - Intronic
1019267091 7:123843-123865 GACACATAAAATCCTGATGGTGG + Intergenic
1019954015 7:4398813-4398835 GGTACCTAAAAGTCTGACCGTGG + Intergenic
1020615213 7:10451500-10451522 GGCATCAAAAACTGTGTTGGTGG - Intergenic
1026394945 7:69942014-69942036 GGCACCTGAATAACTGATGGTGG + Intronic
1026669164 7:72372246-72372268 GGAACCTCAAACTCTGAGGAAGG + Intronic
1032432074 7:131870503-131870525 GGCTCCTAAGACACTAATGGAGG + Intergenic
1038743700 8:30237569-30237591 GGCACTGAAAACTGTGTTGGTGG - Intergenic
1042804216 8:72754440-72754462 GGTCCCTAAAACCCTGAGGGAGG + Intronic
1042971448 8:74413635-74413657 GGAGCCTAAATCTCTGAGGGAGG + Intronic
1044157842 8:88872138-88872160 GTTACCTAAAACTCTTAAGGAGG - Intergenic
1044487948 8:92774835-92774857 ACCAACTAAAACTATGATGGGGG + Intergenic
1048084960 8:131167428-131167450 GGCACCTAAAACTCCAAGAGAGG - Intergenic
1053443830 9:38136432-38136454 GGCGCTTTCAACTCTGATGGAGG - Intergenic
1056813941 9:89786669-89786691 GGCACCCAAAACTCTGAGGAAGG + Intergenic
1056971957 9:91212604-91212626 TGCACCTAAAATGCTGGTGGTGG - Intergenic
1058201407 9:102046395-102046417 GGCAACCAACACTCTTATGGGGG + Intergenic
1185987362 X:4850350-4850372 AGCACCTAAAATTCTGAAGGTGG + Intergenic
1189196462 X:39157835-39157857 GGTTCCTAAATCTTTGATGGGGG - Intergenic
1193685299 X:84570915-84570937 GTCACCAAGAGCTCTGATGGAGG + Intergenic
1195595129 X:106680213-106680235 GGAACTTAAAAGTCTCATGGAGG + Intergenic
1196699171 X:118648844-118648866 CTCACCTAAAACTATGCTGGGGG - Intronic
1198960847 X:142181604-142181626 GGCATCTAAAACTCTGAGTGAGG + Intergenic
1199567883 X:149234929-149234951 AGCACCTAGAACTCTGAGAGGGG + Intergenic
1199892410 X:152099361-152099383 GGCACCTAAACCTCTGAGGAAGG + Intergenic
1201732892 Y:17224495-17224517 GGAACATAAGTCTCTGATGGTGG - Intergenic