ID: 972456089

View in Genome Browser
Species Human (GRCh38)
Location 4:39256802-39256824
Sequence ATCCATCCTGTTCTCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 1, 2: 0, 3: 45, 4: 536}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972456081_972456089 17 Left 972456081 4:39256762-39256784 CCATGGAAGAGTCCCACACTCCT 0: 1
1: 0
2: 1
3: 19
4: 167
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536
972456084_972456089 4 Left 972456084 4:39256775-39256797 CCACACTCCTCTAACAGCCAGGC 0: 1
1: 0
2: 2
3: 27
4: 218
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536
972456085_972456089 -3 Left 972456085 4:39256782-39256804 CCTCTAACAGCCAGGCCTTCATC 0: 1
1: 0
2: 2
3: 13
4: 168
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536
972456080_972456089 27 Left 972456080 4:39256752-39256774 CCAGCTGTTTCCATGGAAGAGTC 0: 1
1: 0
2: 2
3: 9
4: 158
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536
972456079_972456089 28 Left 972456079 4:39256751-39256773 CCCAGCTGTTTCCATGGAAGAGT 0: 1
1: 0
2: 1
3: 19
4: 208
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536
972456082_972456089 5 Left 972456082 4:39256774-39256796 CCCACACTCCTCTAACAGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 155
Right 972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG 0: 1
1: 1
2: 0
3: 45
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972456089 Original CRISPR ATCCATCCTGTTCTCCATCT GGG Intronic
900112584 1:1014809-1014831 ATCCTGCCTGTCCTCCATCTGGG + Intergenic
902270114 1:15297949-15297971 CTCCATGCTGTTTTCCATATTGG - Intronic
904465591 1:30705404-30705426 TTCCAGCCTGTTCTGCAGCTGGG + Intergenic
905150295 1:35921815-35921837 CTCCATTCTGTTCTTCAGCTGGG - Exonic
906014756 1:42565605-42565627 CTCCATACTGTTTTCCATATTGG - Intronic
906297438 1:44657901-44657923 ATTCATCCTGTCCTCCCTATTGG + Intronic
907024004 1:51097339-51097361 CTCCATTCTGTTCTCCATAGTGG - Intergenic
909216340 1:72895227-72895249 CTCCATACTGTTCTCCATAGTGG - Intergenic
909592346 1:77364941-77364963 CTCCATACTGTTCTCCATAGTGG + Intronic
911981314 1:104570253-104570275 CTCCATACTGTTCTCCATATTGG - Intergenic
912540836 1:110413929-110413951 CCCCAACCTGTTCTGCATCTGGG - Intergenic
912877955 1:113381573-113381595 CTCCATACTGTTCTCCATAGTGG + Intergenic
913176808 1:116280796-116280818 CTCCATACTGTTCTCCATGGTGG + Intergenic
915005855 1:152635386-152635408 CTCCATACTGTTCTCCATAGTGG - Intergenic
915262474 1:154687228-154687250 ATCCATCCTATTCTTGATTTGGG + Intergenic
915684049 1:157613196-157613218 TTCCATACTGTTCTCCATAGTGG - Intergenic
915983200 1:160436018-160436040 CTCCATACTGTTCTCCATAGTGG - Intergenic
916807540 1:168273311-168273333 CTCCATACTGTTCTCCATAGTGG + Intergenic
917388551 1:174505719-174505741 ATCCATGCTGTTTTCCATAATGG - Intronic
918873096 1:190002447-190002469 CTCCATACTGTTCTCCATGGTGG + Intergenic
919284544 1:195538781-195538803 CTCCATCCTGTTTTCCATAATGG - Intergenic
919870831 1:201820034-201820056 CTCCCTCCTGTTCTCCTCCTGGG - Exonic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
922044795 1:221934871-221934893 CTCCATACTGTTCTCCATAGTGG - Intergenic
923204630 1:231746520-231746542 TTCCATACTGTTCTCCATTGTGG + Intronic
923877276 1:238062835-238062857 ATCCTTCCTCTGCTCCTTCTCGG + Intergenic
923937593 1:238780676-238780698 CTCCATACTGTTCTCCATCGTGG - Intergenic
1063541342 10:6937529-6937551 AGCCATCCTGTTCCCCCTATTGG - Intergenic
1063880421 10:10525896-10525918 TTCCATCCTGTTTTCCATAATGG + Intergenic
1063996393 10:11624264-11624286 ATCAAGCCTGTTTTCAATCTTGG + Intergenic
1064510938 10:16090770-16090792 CTCCATCCTGTTTTCCATAGTGG - Intergenic
1065255769 10:23866507-23866529 ATACATCCTCTTGACCATCTTGG - Intronic
1065486874 10:26244302-26244324 ATCCATACAGTGCTCCATCATGG - Intronic
1066713512 10:38262048-38262070 TTCCATACTGTTCTCCATAGTGG - Intergenic
1066762698 10:38771090-38771112 CTCCATACTGTTCTCCATAGTGG + Intergenic
1066958881 10:42201366-42201388 CTCCATACTGTTCTCCATAGTGG - Intergenic
1067132600 10:43578287-43578309 CTCCATACTGTTCTCCATAGTGG + Intergenic
1067464724 10:46489301-46489323 ACCCATCCTGTGCTCAATCTAGG - Intergenic
1067622470 10:47895352-47895374 ACCCATCCTGTGCTCAATCTAGG + Intergenic
1067811020 10:49427368-49427390 ATGGATGCTGTTCTCCATGTTGG - Intergenic
1068217767 10:54005728-54005750 TTCCATACTGTTCTCCATAGTGG - Intronic
1068612143 10:59071946-59071968 ATCCATCCTGTTAACACTCTGGG + Intergenic
1068662880 10:59641469-59641491 CTCCATACTGTTCTCCATAGTGG + Intergenic
1069115117 10:64495056-64495078 CTCCATGCTGTTCTCCATAGTGG + Intergenic
1069326472 10:67236901-67236923 ATCCACCCTGTTTTCCATAGTGG - Intronic
1069627432 10:69876937-69876959 GTCCGTCCTGTCCTCCTTCTTGG + Intronic
1069884488 10:71615283-71615305 GGCCATGCTGTTCTCCTTCTGGG + Intronic
1070072665 10:73104865-73104887 CTTCATCCTGTTCTCCATAGTGG - Intergenic
1070272083 10:74966015-74966037 ATCCATGTTCTTATCCATCTGGG + Intronic
1070789099 10:79179100-79179122 ATCCCTCTTCTTCTCCATCCTGG - Intronic
1070939631 10:80332861-80332883 ATCCAGACTGTTCTCCATAGTGG - Intergenic
1071362285 10:84860803-84860825 TTCCATACTGTTTTCCATCATGG + Intergenic
1071501448 10:86206992-86207014 AGCCATCCTGTTTCCCACCTAGG + Intronic
1072092120 10:92138768-92138790 CTCCATGCTGTTCTCCATAGTGG - Intronic
1072177654 10:92944625-92944647 CTCCATCCTGTTTTCCATAATGG + Intronic
1072802633 10:98403707-98403729 GTCCTTCCTGGTCACCATCTAGG + Intronic
1072865055 10:99050406-99050428 ATCCATACTGTTTTCCATAATGG - Intronic
1072911981 10:99510382-99510404 GTCCATACTGTTCTCCATAGTGG - Intergenic
1073910779 10:108341392-108341414 ATCCATACTGTTTTCCATAGAGG - Intergenic
1074978924 10:118603549-118603571 ATCCTCCCTGTGCCCCATCTTGG + Intergenic
1075000106 10:118790522-118790544 CTCCATTCTGTTTTCCATATTGG - Intergenic
1075057675 10:119231900-119231922 CTCCATACTGTTCTCCATCGTGG - Intronic
1075830080 10:125401419-125401441 TTCCATTCTGTTCTCCATAGTGG + Intergenic
1075947649 10:126451257-126451279 ATCCATACTGTTTTCCATAATGG - Intronic
1075988887 10:126815737-126815759 CTCCATACTGTTCTCCATAATGG - Intergenic
1077670071 11:4149271-4149293 TTCCATACTGTTCTCCATAGTGG - Intergenic
1078435837 11:11324926-11324948 ATCCATACTGTTTTCCATAGTGG - Intronic
1079030940 11:16986228-16986250 CTCCATCCTGTTCTCCCTACAGG - Intronic
1080538153 11:33242523-33242545 CTCCATACTGTTCTCCATAGTGG - Intergenic
1080785087 11:35467872-35467894 ATCCACACTGTGCACCATCTTGG + Intronic
1082225123 11:49696600-49696622 CTCCATACTGTTCTCCATAGTGG + Intergenic
1083982847 11:66187879-66187901 CTCCATGCTGTTCTCCATAGTGG + Intronic
1084366811 11:68706859-68706881 CTCCATCCTGCTGTCCCTCTCGG - Intergenic
1085860769 11:80232515-80232537 ATCCATACTGTTGTCCATGATGG - Intergenic
1086170209 11:83827283-83827305 ATACAGACTATTCTCCATCTTGG - Intronic
1087692966 11:101343207-101343229 CTCCATACTGTTTTCCATATAGG + Intergenic
1088323704 11:108580478-108580500 TTCCATACTGTTCTCCATAGTGG - Intronic
1088571262 11:111225979-111226001 CTCCATCCTGTTCTGCATAGTGG - Intergenic
1088602082 11:111489353-111489375 CTCCATACTGTTCTCCATAGTGG - Intronic
1089288890 11:117425846-117425868 ATCCATCCTGTGCTGCATATTGG + Intergenic
1089375596 11:117992271-117992293 ATCCATACTGTTTTCCATAATGG + Intronic
1090233916 11:125132320-125132342 TTACATCCTGTTCTCCTCCTGGG + Intergenic
1090357957 11:126153140-126153162 ATCCATCCTGATGTCCCTCATGG + Intergenic
1090541323 11:127709671-127709693 ATCAATCCTGTTCTCCTCCTGGG + Intergenic
1090996066 11:131866976-131866998 CTCCTCCCTGTTCTCCATCTTGG - Intronic
1092192943 12:6533676-6533698 AGCCATCCTGTCCTCCGCCTGGG + Intergenic
1092803401 12:12195270-12195292 TTCCATACTGTTCTCCATAGCGG + Intronic
1093115323 12:15202869-15202891 ATCCATACTGTTTTCCATAGTGG + Intronic
1093917834 12:24825364-24825386 CTCCATACTGTTCTCCATAGTGG + Intronic
1094426756 12:30324145-30324167 ATCCATCCTGTTTTGGATTTGGG + Intergenic
1094785603 12:33845345-33845367 CTCCATACTGTTCTCCATAGTGG + Intergenic
1094789728 12:33898285-33898307 CTCCATACTGTTTTCCATCAAGG + Intergenic
1095354319 12:41253560-41253582 CTCCATCCTGTTCTTCATATTGG - Intronic
1095408944 12:41901135-41901157 CTCCATCCTGTTTTCCATAATGG - Intergenic
1095432863 12:42152862-42152884 CTCCAACCTGTTCTCCATAGTGG - Intergenic
1095682459 12:44994274-44994296 ATGCAGCCTCTTCTGCATCTGGG + Intergenic
1096598327 12:52712052-52712074 CTCCATACTGTTTTCCATCATGG + Intergenic
1097310709 12:58115534-58115556 CTCCATACTGTTCTCCATATTGG + Intergenic
1098899934 12:76102108-76102130 ATTCATTCTCTTCTCCTTCTGGG + Intergenic
1099402624 12:82218800-82218822 ATTCATCTTGTTCTCACTCTAGG + Intergenic
1100352751 12:93800283-93800305 ATCCATCCTCTCCTGCATTTGGG - Intronic
1100908911 12:99335933-99335955 CTCCATACTGTTCTCCATAGTGG + Intronic
1100958153 12:99932344-99932366 CTCCATACTGTTCTCCATAGTGG + Intronic
1101499743 12:105291800-105291822 CTCCATCCTGTTTTCCATAGTGG - Intronic
1101522885 12:105501428-105501450 ATCCATACTGTTTTCCATAATGG - Intergenic
1101760268 12:107652494-107652516 TTACAGCCTGTTCTCAATCTTGG - Intronic
1101837009 12:108302914-108302936 ATCCCTCCACTTCTCCATCAGGG - Intronic
1102267512 12:111500032-111500054 TTCCATACTGTTCTCCATAGTGG - Intronic
1104404832 12:128508664-128508686 AACTGTCCTGTTCTCCCTCTTGG + Intronic
1104723598 12:131060916-131060938 GTCCACTCTGTTCTCCATCCAGG - Intronic
1105047707 12:133019637-133019659 CTCCATACTGTTCTCCATAGTGG - Exonic
1105537741 13:21285263-21285285 CTCCATGCTGTTCTCCATAGTGG - Intergenic
1106541744 13:30696719-30696741 TTCCTTCCTGTTCTCCTTCAGGG - Intergenic
1107575333 13:41713314-41713336 ATGCATCCTTTTCTCTTTCTAGG + Intronic
1107652883 13:42562285-42562307 ATACATCCTGTTTTGCTTCTTGG + Intergenic
1108037217 13:46303837-46303859 CTCCATACTGTTCTCCATAGTGG - Intergenic
1110842546 13:80158883-80158905 ATCCATCCTATCTTCCAACTTGG - Intergenic
1111014057 13:82353842-82353864 ATCCATCCTGTTTTCCATAATGG - Intergenic
1111261518 13:85746501-85746523 ATCCATCCTGTGTTCCCTTTGGG + Intergenic
1111289641 13:86148195-86148217 CTCCATACTGTTCTCCATAGTGG - Intergenic
1111335499 13:86816101-86816123 CTCCATACTGTTCTCCATAGTGG - Intergenic
1111442599 13:88299810-88299832 CTCCATACTGTTCTCCATAAGGG + Intergenic
1111550140 13:89798435-89798457 ATCCGTACTGTTTTCCATCATGG + Intergenic
1112803743 13:103139440-103139462 CTCCATGCTGTTCTCCATAAAGG - Intergenic
1113225019 13:108150121-108150143 ATGGATCCACTTCTCCATCTGGG + Intergenic
1113626097 13:111847928-111847950 CTCCATACTGTTCTCCATCATGG + Intergenic
1113645479 13:111992148-111992170 AGCAGTCCTGTTCTCCATCCAGG + Intergenic
1114368987 14:22064465-22064487 CTCCATACTGTTCTCCATAGTGG - Intergenic
1114992678 14:28307350-28307372 CTCCATACTGTTTTCCATATTGG + Intergenic
1115778752 14:36746025-36746047 CTCCATCCTGTTTTCCATAGAGG - Intronic
1116214851 14:42001475-42001497 CTCCATACTGTTCTCCATAGTGG + Intergenic
1116413012 14:44647900-44647922 ACCCATTCTGTCCTCAATCTGGG + Intergenic
1116413439 14:44651768-44651790 CTCCATGCTGTTCTCCATAGTGG - Intergenic
1116480204 14:45387962-45387984 ATCCATCATCTTCTCACTCTAGG - Intergenic
1116713953 14:48405192-48405214 ATCCATACTATTCTCCATAGTGG + Intergenic
1117165745 14:53031127-53031149 ATACATCCTGTTTTGCATTTGGG + Intergenic
1118500438 14:66357193-66357215 AACCATTCTGTGCTCCTTCTGGG - Intergenic
1119152918 14:72380740-72380762 CTCCATACTGTTCTCCATAGTGG - Intronic
1120273045 14:82338531-82338553 ATCCATCTGGTTCCTCATCTTGG - Intergenic
1121920936 14:97880801-97880823 CTCCATACTGTTCTCCATAATGG - Intergenic
1122244268 14:100390676-100390698 CTCCATCCTGTCCTCCAGCTTGG + Intronic
1122410344 14:101522543-101522565 TTCCATCCTGCTCTCCTTCGAGG - Intergenic
1122537559 14:102476546-102476568 TTCCAGCCTGTTTTCCCTCTGGG - Intronic
1123147600 14:106148624-106148646 CTCCATACTGTTTTCCATCGAGG + Intergenic
1123163120 14:106299439-106299461 ATCCATACTGTTCTCTATAGAGG + Intergenic
1202893572 14_KI270722v1_random:182672-182694 AATCGTCCTGTTCTCCATATAGG + Intergenic
1202934021 14_KI270725v1_random:67346-67368 CTCCATACTGTTCTCCATAGTGG + Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1123755219 15:23392545-23392567 CTCCATGCTGTTCTCCATAGCGG + Intergenic
1123845018 15:24291390-24291412 TTTCATCCTGTTGTCCAGCTAGG + Intergenic
1125253120 15:37729464-37729486 CTCCATACTGTTCTCCATCATGG + Intergenic
1126717253 15:51531943-51531965 CTCCATACTGTTCTCTATCATGG - Intronic
1126874541 15:53026016-53026038 CTCCATACTGTTCTCCATAGTGG + Intergenic
1127045657 15:55022704-55022726 CTCCATACTGTTCTCCATAAAGG + Intergenic
1127810742 15:62563165-62563187 CTCCATCCTGTTTTCCATGGTGG + Intronic
1128359544 15:66952075-66952097 CTCCATACTGTTCTCCATTGTGG + Intergenic
1128740472 15:70080213-70080235 CTCCATCCTTCCCTCCATCTCGG + Intronic
1129511441 15:76126129-76126151 ATCCATACTGTTTTCCATACTGG - Intronic
1130316611 15:82801905-82801927 ACTCATCCTTCTCTCCATCTAGG - Intronic
1130399934 15:83541547-83541569 TTCCAAACTGTTCTCCATCGTGG + Intronic
1130419155 15:83725124-83725146 CTCCATACTGTTCTCCATAGTGG + Intronic
1130569925 15:85033308-85033330 ATCCAGCCTCTTCTGCATCCTGG - Intronic
1131239545 15:90727002-90727024 TTCCATACTGTTCTCCATAGTGG + Intronic
1131415204 15:92249816-92249838 ATCCAACCTGTTCTCCATAGTGG + Intergenic
1131661126 15:94518287-94518309 CTCCATACTGTTCTCCATAATGG - Intergenic
1133097934 16:3459969-3459991 ATCCCTCCTGGTCTCCTTTTAGG - Intronic
1134461156 16:14430464-14430486 CTCCATGCTGTTCTCCATAGCGG - Intergenic
1134528550 16:14963798-14963820 ATCCATCCTTTTTGCCTTCTGGG - Intergenic
1134780899 16:16894690-16894712 ATCCATACTGTTTTCCATGGTGG - Intergenic
1134781252 16:16897734-16897756 ATCCATACTGTTTTCCATAGTGG + Intergenic
1134875698 16:17696718-17696740 TCCCTTCCTGGTCTCCATCTGGG - Intergenic
1137281671 16:46982205-46982227 ATCCATGCTGTTCTCCATAGTGG + Intergenic
1137324279 16:47417949-47417971 ATCCATACTGTTTTCCATAATGG + Intronic
1137880512 16:52041649-52041671 CTCCATCCTGTTTTCCATGATGG + Intronic
1138469244 16:57219230-57219252 CTCCATACTGTTCTCCATAGTGG + Intronic
1139046838 16:63071141-63071163 CTCCATACTGTTCTCCATCATGG + Intergenic
1139142352 16:64281937-64281959 TTCCATCCTGTTTTCCATAGTGG - Intergenic
1141255410 16:82397406-82397428 CTGCATGCAGTTCTCCATCTTGG + Intergenic
1141327382 16:83074570-83074592 ATCCATACTGTTTTCCATAATGG + Intronic
1141627509 16:85268988-85269010 ATCCATCCTTTCCTCCCTCCTGG - Intergenic
1141855993 16:86681859-86681881 ATCCACCCAGTCCTCCAACTGGG + Intergenic
1142306153 16:89287088-89287110 ATCCTTCCTTTCCTCCATCATGG + Intronic
1142330991 16:89453755-89453777 ATACTTCCTGTTCTTCTTCTTGG - Intronic
1144322836 17:14147067-14147089 CTCCAAACTGTTCTCCATATTGG - Intronic
1145114859 17:20199684-20199706 CTCCATACTGTTCTCCATAATGG + Intronic
1146995125 17:37313774-37313796 CTCCATACTGTTCTCCATAGTGG - Intronic
1147487387 17:40830043-40830065 CTCCATACTGTTCTCCATAGTGG - Intronic
1150264942 17:63826336-63826358 AGCCATCCTTTTCCCCCTCTTGG + Intronic
1150535535 17:66035515-66035537 CTCCATACTGTTCTCCATAATGG - Intronic
1150800886 17:68281833-68281855 CTCCATACTGTTCTCCTTATTGG - Intronic
1151770129 17:76155254-76155276 CTGCATCCTGCTCTCCAGCTGGG + Exonic
1153255804 18:3169718-3169740 CTCCATACTGTTCTCCATAGTGG - Intronic
1153499561 18:5734233-5734255 CTCCATCCTGTTTTCCATACAGG - Intergenic
1153875617 18:9368034-9368056 CTCCATACTGTTCTCCATAATGG + Intronic
1153883849 18:9445716-9445738 TTCCATACTGTTCTCCATAGTGG + Intergenic
1154012245 18:10584961-10584983 ATCCATACTGTTCTCCATAGTGG + Intergenic
1154043603 18:10883337-10883359 GTCCATACTGTTCTCCATAATGG + Intronic
1155245938 18:23909029-23909051 ACCCATCCTGTTCAACATCTGGG + Intronic
1155286614 18:24294984-24295006 CTCCATACTGTTCTCCATAGAGG + Intronic
1156046353 18:32881720-32881742 ATCCATCCTCTTCCCCACCATGG + Intergenic
1156124378 18:33885741-33885763 CTCCAAACTGTTCTCCATATTGG - Intronic
1156133797 18:34010624-34010646 GTCCATACTGTTCTCCATAGTGG + Intronic
1157065073 18:44340211-44340233 CTCCATACTGTTTTCCATATTGG + Intergenic
1157240123 18:46001164-46001186 CTCCATACTGTTCTCCATAGTGG + Intronic
1157545439 18:48543238-48543260 GTACCTCCTGTTCTCTATCTGGG - Intronic
1158152196 18:54386210-54386232 CTCCATCTTGTTCTACATCCTGG - Intergenic
1158267326 18:55674416-55674438 TTCCATGCTGTTCTCCATAGTGG + Intergenic
1159475916 18:68920825-68920847 ATTCAACCTGTTCTCCCTTTTGG + Intronic
1160274053 18:77413820-77413842 CTCCATTCTGCTCTCCCTCTAGG + Intergenic
1161003497 19:1923136-1923158 AGCCATCATGTTCTCCGTGTCGG + Exonic
1163196559 19:15725584-15725606 TTCCATACTGTTCTCCATAGTGG + Intergenic
1164637710 19:29803439-29803461 CTCCATACTGTTCTCCATAGTGG - Intergenic
1164771319 19:30811610-30811632 ATCCCTCCTGCTCTCCTGCTGGG + Intergenic
1165153596 19:33774600-33774622 ATCCAGCATTTCCTCCATCTGGG - Intergenic
1166361071 19:42253316-42253338 CTCCATCCAGTTCTCCATCCCGG - Intronic
1167647039 19:50711522-50711544 ACCCAGGCTGTTCTCCCTCTGGG + Intronic
1168118086 19:54236473-54236495 CTCCATGCTGTTTTCCATATTGG - Intronic
925228661 2:2209869-2209891 CTCCAACCTGTTCTCCATAGTGG + Intronic
925450680 2:3966914-3966936 ATGCATCCAGTTCTCCCCCTTGG - Intergenic
925568376 2:5281986-5282008 CTCCATCCTGTTTTCCATAAAGG - Intergenic
925573977 2:5341043-5341065 ATCCATCCATTTATCCATTTGGG - Intergenic
925816408 2:7755378-7755400 ATCCATCCTTTCCTCTTTCTTGG - Intergenic
925993462 2:9272129-9272151 CTCCATACTGTTCTCCATAGTGG + Intronic
926244809 2:11114947-11114969 CTCCATACTGTTCTCCATAATGG - Intergenic
926870003 2:17405610-17405632 TTCCATACTGTTCTCCATAGTGG - Intergenic
927044998 2:19268971-19268993 CTCCATACTGTTTTCCATTTTGG - Intergenic
927619567 2:24638560-24638582 CTCCATACTGTTCTCCATAGTGG + Intronic
927853304 2:26513286-26513308 ATTCATCCTGTCCTCACTCTGGG - Intronic
927870502 2:26619985-26620007 CACCATCCTGATCTCCATCCCGG + Intronic
928384762 2:30857563-30857585 CTCCATACTGTTCTCCATAGTGG - Intergenic
928679333 2:33683289-33683311 TTCCATACTGTTCTCCATAGTGG + Intergenic
930772664 2:55143356-55143378 CTCCATACTGTTTTCCATCAGGG - Intergenic
931186397 2:59955911-59955933 CTCCATACTGTTCTCCATAATGG - Intergenic
931529762 2:63200260-63200282 CTCCAACCTGTTCTCCATAGTGG - Intronic
931927642 2:67091533-67091555 TTCCATACTGTTCTCCATAGTGG - Intergenic
932015449 2:68022283-68022305 CTCCATACTGTTCTCCATAGTGG + Intergenic
933131317 2:78677126-78677148 CTCCATCTTGTTCTACATCCTGG - Intergenic
933175856 2:79172212-79172234 CTCCATACTGTTCTCCATAGTGG - Intergenic
934307235 2:91836999-91837021 CTCCATACTGTTCTCCATAGTGG - Intergenic
934326022 2:92015714-92015736 CTCCATACTGTTCTCCATAGTGG + Intergenic
934464374 2:94246363-94246385 CTCCATACTGTTCTCCATAGTGG + Intergenic
934791596 2:97067036-97067058 ATCCACCCTGTGATACATCTAGG + Intergenic
934895126 2:98111469-98111491 CTCCATCCTGTTTTCCATAGAGG + Intronic
935384892 2:102489635-102489657 ATCCATTCAGTTCACCAGCTTGG + Intronic
936474054 2:112824298-112824320 CTCCATCCTGTTCTCTTGCTTGG + Intergenic
936488100 2:112944359-112944381 CTCCATACTGTTCTCCATAATGG + Intergenic
936940657 2:117880867-117880889 CTCCATACTGTTCTCCATAATGG + Intergenic
938249651 2:129804885-129804907 TCCCATCCTGTTCGTCATCTGGG - Intergenic
939418810 2:141938509-141938531 CTCCATACTGTTCTCCATAAAGG - Intronic
939511866 2:143117108-143117130 ATCCATACTGCTTTCCATATTGG - Intronic
940237569 2:151527345-151527367 AACCATCCTCCTCTCCTTCTCGG + Intronic
940517543 2:154699270-154699292 GTCCATCCTGGGCTCCATCGTGG + Exonic
940734758 2:157437944-157437966 CTCCATACTGTTCTCCATAGTGG - Intronic
941365394 2:164604852-164604874 CTCCATTCTCTTCTCCGTCTCGG - Intronic
941476807 2:165959763-165959785 CTCCATCCTGTTATCCATAATGG + Intergenic
941478641 2:165978034-165978056 TTCCATCCTGTTTTCCATAATGG - Intergenic
943451895 2:188052998-188053020 ATTCTTCATTTTCTCCATCTAGG - Intergenic
943761651 2:191616334-191616356 ATACATACTGTTCTGCAGCTTGG + Intergenic
946628419 2:221640332-221640354 CTCCATACTGTTCTCCATAGTGG + Intergenic
947083238 2:226421827-226421849 ATCCATCCTGTCTTACAACTTGG + Intergenic
947305225 2:228738817-228738839 TTCCATACTGTTCTCCATAGTGG + Intergenic
947492963 2:230611617-230611639 AGTCATCCTGTTGTCCATCCTGG + Intergenic
1169397488 20:5245864-5245886 ATCCATGCTGTTTTCCATAGTGG + Intergenic
1169452005 20:5719879-5719901 CTCCATTCTGTTCTGCATCCTGG - Intergenic
1169624327 20:7546841-7546863 CTCCATACTGTTCTCCATAATGG - Intergenic
1170050236 20:12134863-12134885 ATTCATACTGTTCTCCATAGTGG + Intergenic
1173423844 20:42926269-42926291 CTCTCTCCTGTTCTCCATCCTGG + Intronic
1173643197 20:44617613-44617635 ATCCATCCTGTCAGACATCTTGG - Intronic
1173704013 20:45096904-45096926 ATTCATCCTGTTCTCTCTCCAGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1173888715 20:46485334-46485356 ATTCATCCTTTTATCCATTTGGG - Intergenic
1174058147 20:47813656-47813678 AGCCATACTGTTTTCCATATGGG - Intergenic
1174293933 20:49530496-49530518 CTCCATACTGTTCTCCATGATGG + Intronic
1174436536 20:50510809-50510831 CTCCCTTCTGTTCTCCAGCTCGG + Intronic
1174691312 20:52509144-52509166 CTCCATACTGTTCTCCATAGTGG - Intergenic
1175395805 20:58660674-58660696 ATCCATGCTGCTCTGCATCTGGG - Intronic
1175703187 20:61155295-61155317 AGACATCCTGTTATCCATCTTGG - Intergenic
1176595425 21:8689505-8689527 CTCCATACTGTTCTCCATAGTGG + Intergenic
1176930082 21:14799314-14799336 CTCCATACTGTTCTCCATAGCGG + Intergenic
1177777639 21:25586680-25586702 ATTCATCATGTTCTCTATGTAGG + Intronic
1178188493 21:30253360-30253382 ATCCATACTGTTCTCCATCTTGG - Intergenic
1179229940 21:39492693-39492715 ATCCATACTGTTTTCCATAGTGG + Intronic
1180278281 22:10666655-10666677 CTCCATACTGTTCTCCATAGTGG + Intergenic
1180585530 22:16885498-16885520 CTCCATACTGTTCTCCATAGTGG + Intergenic
1180628862 22:17213259-17213281 ATCCATACTGTTCTCCATAGTGG - Intronic
1180868313 22:19132379-19132401 CTCCATCCTGTTCTCGTTCTCGG - Exonic
1181963578 22:26640742-26640764 CTCCATCCTGTTCTCCATAACGG + Intergenic
1183757616 22:39784317-39784339 CTCCATACTGTTCTCCATAGTGG - Intronic
1185280236 22:49966781-49966803 ACCCATCCTGGTCGACATCTGGG + Intergenic
1185313495 22:50169509-50169531 CTCCGTCCTGTTCTCCCTCGGGG - Intergenic
950684817 3:14608889-14608911 ATATCTCCTTTTCTCCATCTTGG + Intergenic
951703857 3:25524465-25524487 AACCACCATCTTCTCCATCTTGG + Intronic
951977024 3:28522451-28522473 ATCCATCTTTTTCTACATCTAGG - Intronic
952028070 3:29108069-29108091 CTCCATACTGTTCTCCATAGTGG - Intergenic
952437897 3:33290475-33290497 ATCCATGTTGTTCAACATCTGGG - Intronic
952441017 3:33329336-33329358 CTCCATACTGTTCTCCATAGTGG - Intronic
952592902 3:34979080-34979102 CTCCATACTGTTCTCCATAATGG - Intergenic
953100702 3:39823423-39823445 CTCCATACTGTTCTCCATAGTGG + Intronic
953473262 3:43184535-43184557 ACCATTCCTGGTCTCCATCTGGG - Intergenic
954628592 3:52036174-52036196 ATCCCCCCTGTCCTCCAGCTGGG + Intergenic
955532729 3:59891175-59891197 ATCCTTCCAGTTGTCCAGCTGGG + Intronic
955862635 3:63348102-63348124 ATCCATTCTGTTTTCCATAGAGG + Intronic
957537350 3:81524069-81524091 CTCCATACTGTTCTCCATACTGG + Intronic
957612378 3:82484896-82484918 CTCCATACTGTTCTCCATAGTGG + Intergenic
957725039 3:84053230-84053252 CTCCATACTGTTTTCCATATGGG + Intergenic
957776082 3:84758753-84758775 CTGCCTCCTATTCTCCATCTTGG - Intergenic
957797826 3:85034664-85034686 CTCCATACTGTTCTCCATAATGG + Intronic
957818249 3:85331691-85331713 CTCCATACTGTTCTCCATAATGG + Intronic
957952297 3:87141974-87141996 CTCCATCTTGTTTTACATCTGGG + Intergenic
958075162 3:88666882-88666904 ATCCAGGCAGTTCTCCATTTGGG + Intergenic
958839833 3:99190777-99190799 TTCCATACTGTTCTCCATAGTGG - Intergenic
958857653 3:99405936-99405958 CTCCATACTGTTCTCCATAGTGG - Intergenic
959779646 3:110214100-110214122 ATCCATATTGTTCTCCATAATGG - Intergenic
959834231 3:110899578-110899600 AGCCATGCTGTCCACCATCTTGG + Intergenic
959842145 3:110989856-110989878 CTCTATACTGTTCTCCATCTTGG - Intergenic
961321580 3:126080624-126080646 TTCCATACTGTTCTCCATAGTGG - Intronic
961351172 3:126305069-126305091 AACTCTCCTTTTCTCCATCTTGG + Intergenic
962175565 3:133150652-133150674 ATCCATCATGTTCTTGGTCTGGG - Intronic
962332492 3:134490835-134490857 ATGTATACTGTTTTCCATCTTGG + Intronic
962628799 3:137254896-137254918 TTCCATCCTGTTGTCCATAATGG - Intergenic
962976458 3:140450308-140450330 ATCCATCCAGGCCTCCATCCAGG + Intronic
963107025 3:141656163-141656185 ATCCTTCTTGTTCTTCCTCTTGG - Intergenic
963216886 3:142758205-142758227 CTCCATACTGTTCTCCATAGTGG + Intronic
963672466 3:148269324-148269346 AGCCATCCTTCTCTCCTTCTGGG + Intergenic
964208195 3:154198298-154198320 CTCCATACTGTTTTCCATATTGG - Intronic
964295934 3:155233181-155233203 AGCCGTCCTGTTCTCTATTTAGG + Intergenic
964541013 3:157780046-157780068 ATCCATACTGTTTTCCATAATGG - Intergenic
965037862 3:163465918-163465940 CTCCATACTGTTCTCCATAGTGG + Intergenic
965162078 3:165146553-165146575 CTCCATGCTGTTTTCCATATTGG + Intergenic
966475732 3:180343580-180343602 CTCCATACTGTTCTCCATAGTGG + Intergenic
966730674 3:183148765-183148787 ATCCAAACTTTTCTCCATCTTGG - Intronic
967640497 3:191857093-191857115 ATCCATACTGTTTTCCATAATGG + Intergenic
967771191 3:193335044-193335066 AGGCATAGTGTTCTCCATCTGGG + Exonic
969139766 4:5058461-5058483 ATCCATGTTGTTCTCACTCTGGG - Intronic
970376591 4:15463922-15463944 AAACATCCTGTGCTCTATCTTGG - Intergenic
970821336 4:20218731-20218753 CTCCATACTGTTCTCCATAGTGG + Intergenic
972033382 4:34491248-34491270 CTCCATACTGTTCTCCATAGAGG + Intergenic
972456089 4:39256802-39256824 ATCCATCCTGTTCTCCATCTGGG + Intronic
972523153 4:39881371-39881393 CTCCATACTGTTCTCCATAATGG + Intronic
973026018 4:45272139-45272161 ATCCATACTGTTTTCCATAATGG - Intergenic
973036871 4:45417757-45417779 ATCCATACTGTTCTCCATAGTGG + Intergenic
973053737 4:45628887-45628909 ATCCATACTGTTCTCCATACTGG + Intergenic
974040143 4:56850306-56850328 ATCCATACTGTTTTCCATAGTGG + Intergenic
974254093 4:59427235-59427257 ATCCATACTGTTTTCCATAATGG + Intergenic
975217751 4:71776072-71776094 ATCCATACTGTTTTCCATAATGG - Intronic
975463128 4:74677897-74677919 ATCCAAACTGTTCTCCATAGTGG + Intergenic
976021170 4:80628889-80628911 ATCCATACTGTTTTCCATAATGG - Intronic
976139606 4:81977213-81977235 CTCTGTCCTGTTCCCCATCTTGG + Intronic
976161646 4:82207293-82207315 CTCCATACTGTTCTCCATGGTGG - Intergenic
976318466 4:83684792-83684814 CTCCATACTGTTCTCCATAGTGG + Intergenic
976385766 4:84456231-84456253 ACCCTTCCTTTTCTCCATTTTGG - Intergenic
976406635 4:84666652-84666674 CTCCATACTGTTCTCCATAGTGG - Intergenic
976742866 4:88375204-88375226 CTCCATACTGTTCTCCATAGTGG - Intergenic
976762244 4:88562065-88562087 CTCCATACTGTTCTCCATAGTGG + Intronic
977650223 4:99460816-99460838 ATCCATCCTGCTCTGTAACTGGG + Intergenic
978059279 4:104316497-104316519 ATCCATACTGTTTTCCATAGTGG - Intergenic
978082430 4:104610421-104610443 ATCCAGACTGTTCTCCATAGTGG + Intergenic
978098648 4:104809970-104809992 CTCCATACTGTTCTCCATTGTGG - Intergenic
978192090 4:105925588-105925610 ACCCATGCTGTTCTCCATTCTGG - Intronic
978206290 4:106084057-106084079 CTCCATCCAGTTCTGCACCTTGG - Intronic
978244557 4:106557378-106557400 CTCCATACTGTTCTCCATGGTGG - Intergenic
978351262 4:107823352-107823374 TTCCATACTGTTCTCCATAGTGG + Intergenic
978356639 4:107882180-107882202 CTCCATACTGTTCTCCATAGTGG + Intronic
978994774 4:115137163-115137185 ATCCATACTGTTCTTCATAGAGG - Intergenic
979077343 4:116289560-116289582 ATGAATCCTAATCTCCATCTTGG + Intergenic
979142216 4:117191235-117191257 CTCCATACTGTTCTCCATAGTGG + Intergenic
979184922 4:117776175-117776197 CTCCATACTGTTCTCCATAGTGG - Intergenic
979377906 4:119969783-119969805 CTCCATACTGTTCTCCATAGTGG + Intergenic
980248544 4:130281276-130281298 ATCCATACTGTTTTCCATAGAGG + Intergenic
980630920 4:135432059-135432081 CTCCATGCTGTTCTCCATAGTGG - Intergenic
980799246 4:137727630-137727652 ATCTATACTGTTCTCCATGGTGG + Intergenic
980977648 4:139626224-139626246 CTCCATACTGTTCTCCATAGTGG - Intergenic
981297600 4:143150075-143150097 CTCCATACTGTTCTCCATAGTGG + Intergenic
981564552 4:146085411-146085433 ATCCATACTGTTTTCCTTCATGG - Intergenic
982335180 4:154228442-154228464 CTCCATACTGTTCTCCATAGTGG - Intergenic
983428370 4:167616501-167616523 CTCCATCCTGTTTTCCATAGTGG + Intergenic
983780004 4:171658246-171658268 TTCCATACTGTTTTCCATCATGG + Intergenic
983896654 4:173088318-173088340 CTCCATACTGTTCTCCATAGTGG + Intergenic
984634701 4:182098254-182098276 CTCCATCCTGTTCTTCATACTGG - Intergenic
985231049 4:187818110-187818132 CTCCATACTGTTCTCCATAGTGG + Intergenic
985611843 5:893428-893450 AGCCATCCTATTCTCCAACGTGG - Intronic
986651692 5:9970516-9970538 CTCCATACTGTTCTCCATAGTGG - Intergenic
987009226 5:13743878-13743900 TTCCATACTGTTCTCCATAGTGG - Intronic
987134245 5:14886031-14886053 CTCCATACTGTTTTCCATCCAGG - Intergenic
987151966 5:15051117-15051139 CTCCATATTGTTCTCCATATTGG + Intergenic
987235736 5:15939533-15939555 ATCCATTCTGTTCTCCCTTGGGG + Exonic
987643316 5:20639209-20639231 ATCCATACTGTTTTCCATAAAGG - Intergenic
987989009 5:25186313-25186335 ATCCATACTGTTTTCCATAATGG - Intergenic
988533178 5:32042831-32042853 GGCCTTCCTGTTGTCCATCTTGG + Intronic
988607842 5:32695592-32695614 CTCCAACCTGTTCTCCATAGTGG + Intronic
988984938 5:36608449-36608471 CTCCATCCTGCCCCCCATCTTGG - Exonic
989443485 5:41501125-41501147 TTCCATTCTGTTCTCCATAGAGG - Intronic
991169605 5:63605824-63605846 CTCCATACTGTTCTCCATAGTGG - Intergenic
991238785 5:64431949-64431971 CTCCATACTGTTCTCCATAGTGG - Intergenic
991348766 5:65698952-65698974 CTCCATACTGTTTTCCATATAGG - Intronic
992012523 5:72543116-72543138 CTTCATACTGTTCTCCATCGTGG + Intergenic
993699832 5:91105408-91105430 CTCCATACTGTTCTCCATAGTGG + Intronic
996298713 5:121955567-121955589 GTCCATACTGTTCTCCATAGTGG + Intergenic
996444955 5:123537007-123537029 CTCCATACTGTTTTCCATATAGG - Intronic
996675833 5:126173062-126173084 ATCCATCCCATCCTCCATCCAGG - Intergenic
996890680 5:128415771-128415793 ATCCATACTGTTTTCCATATTGG + Intronic
996904053 5:128577399-128577421 CTCCATACTGTTCTCCATAGTGG + Intronic
996906078 5:128601870-128601892 AACCATACTGTTCTCCATAGTGG + Intronic
997071539 5:130628258-130628280 CTCCAAACTGTTCTCCATATTGG + Intergenic
997945924 5:138201356-138201378 ATCCATCAAGTTCTCGAGCTTGG + Exonic
998759220 5:145413401-145413423 CTCCATACTGTTTTCCATATTGG - Intergenic
999118017 5:149181917-149181939 ATGCATCCTGCACACCATCTGGG + Intronic
999229220 5:150051916-150051938 AACCATCCTGGCCTCCATCGTGG + Exonic
999327872 5:150654596-150654618 CTCCAAGCTGTTCACCATCTTGG + Intronic
999350649 5:150867550-150867572 ATCCATACTGTTTTCCATAGTGG + Intronic
1000432843 5:161170720-161170742 ATCCATACTGTTTTCCATAATGG + Intergenic
1002668734 5:180847434-180847456 ATCTATCCTGTGCTCCTCCTAGG + Intergenic
1002955305 6:1856834-1856856 ATCCTTCCTTATGTCCATCTTGG + Intronic
1003001897 6:2343646-2343668 CTCCATGCTGTTCTCCATAGTGG - Intergenic
1003132793 6:3409983-3410005 CTCAATCCTGATCTCCAGCTCGG - Intronic
1003671828 6:8166251-8166273 ATCCATTCTCTTCTCTGTCTTGG + Intergenic
1003677048 6:8214795-8214817 AGCAAACTTGTTCTCCATCTGGG + Intergenic
1004256336 6:14068128-14068150 CTCCTTCCTTTCCTCCATCTGGG - Intergenic
1004458599 6:15814700-15814722 CTCCATACTGTTCTCCATAGTGG + Intergenic
1004756481 6:18615978-18616000 GTCTCTCCTCTTCTCCATCTGGG - Intergenic
1006612288 6:35301373-35301395 ATCCGTACTGCTCCCCATCTGGG + Intronic
1007038612 6:38701140-38701162 CTCCACCCTGTTCTGCTTCTGGG - Intronic
1008002147 6:46371709-46371731 CTCCATCTTGATCTCCATCTAGG - Intronic
1008114435 6:47531555-47531577 AATCCTCCTGTTCTCCATATTGG + Intronic
1008962636 6:57281371-57281393 CTCCATACTGTTCTCCATAGTGG + Intergenic
1009493611 6:64323829-64323851 ATCCATCCAGATCTCCCTCTAGG + Intronic
1009563056 6:65273866-65273888 AATCCTCCTGTTCTCCATATTGG + Intronic
1010028115 6:71243387-71243409 ATCCATACTGTTTTCCATAGTGG - Intergenic
1010130042 6:72481200-72481222 CTCCATACTGTTCTCCATAGTGG - Intergenic
1010139734 6:72600693-72600715 ATCCAAACTGTTCTCCATAGTGG + Intergenic
1010933893 6:81837089-81837111 ATCCCTCTTGTTATCTATCTGGG - Intergenic
1011520944 6:88205343-88205365 CTCCATACTGTTCTCCATAGTGG - Intergenic
1011630550 6:89319809-89319831 ATCCATTCTGTTTTCCATAGAGG - Intergenic
1011840342 6:91489887-91489909 ATCCATACTGTTTTCCATAGAGG - Intergenic
1011873216 6:91923422-91923444 TTCCATACTGTTCTCCATCATGG - Intergenic
1011951704 6:92974891-92974913 TTCCATACTGTTCTCCATTGTGG - Intergenic
1012059427 6:94459767-94459789 ATCCATACTGTTCTACATAGTGG + Intergenic
1012842137 6:104342782-104342804 TTCCATCCTGTTTTCCATAATGG - Intergenic
1014060909 6:117070600-117070622 CTCCATCCTGTTTTCCATAGTGG + Intergenic
1014117879 6:117686715-117686737 ATTCATCCTGTTTCCCTTCTAGG - Intronic
1014275293 6:119381222-119381244 ATCCAAACTGTTCTCCATAGCGG + Intergenic
1014455355 6:121627336-121627358 TACCATCCTCTTCTCCATCCAGG + Intergenic
1014532454 6:122575322-122575344 CTCCATACTGTTTTCCATCGTGG - Intronic
1015088824 6:129329753-129329775 ATCCATCCTCCTCTACATCAGGG + Intronic
1015817336 6:137224249-137224271 AGTCATCCTCTTCTCCATCATGG - Intergenic
1016836068 6:148478100-148478122 CTCCATACTGTTCTCCATAGTGG - Intronic
1017425047 6:154311867-154311889 TTCCATACTGTTTTCCATATTGG - Intronic
1018071831 6:160171472-160171494 CTCTATTCTGTCCTCCATCTTGG - Intronic
1018660646 6:166083598-166083620 CTCCATACTGTTCTCCATAGGGG - Intergenic
1020339839 7:7098367-7098389 ATGCATCCTTTTCCACATCTAGG + Intergenic
1020673109 7:11144284-11144306 ATCCATACTGTTTTCCATAATGG - Intronic
1021623189 7:22567622-22567644 CTCCATACTGTTCTCCATAGTGG + Intronic
1024660729 7:51491278-51491300 CTCCAACCTGTTCTCCATAGCGG + Intergenic
1025766559 7:64459900-64459922 AATCCTCCTGTTCTCCATATCGG - Intergenic
1025973086 7:66346398-66346420 CTCCATACTGTTCTCCATGGTGG + Intronic
1026113093 7:67473940-67473962 CGCCTTCCTCTTCTCCATCTGGG + Intergenic
1026480653 7:70776456-70776478 TTCCTTCCTGTTCTCTATCTAGG - Intronic
1026491486 7:70867854-70867876 CTCCATTCTGTTCCCCATCGTGG + Intergenic
1026534405 7:71228209-71228231 AGCCATCCTGTACTCCTGCTTGG - Intronic
1027796628 7:82702218-82702240 ATTCATCCTTTTAACCATCTGGG - Intergenic
1028041572 7:86060285-86060307 ATCCATACTGTTCTCCATAGTGG + Intergenic
1028169369 7:87577480-87577502 CCCCATACTGTTCTCCATCATGG + Intronic
1028355846 7:89906518-89906540 CTCCATACTGTTCTCCATAGTGG + Intergenic
1030126638 7:106158955-106158977 ATCCATACTGTTTTCCATAATGG + Intergenic
1030285168 7:107818592-107818614 CTCCATACTGTTCTCCATAGTGG - Intergenic
1030395880 7:108986271-108986293 ATCCACCATCTTCTCCATTTTGG + Intergenic
1030474748 7:110016495-110016517 CTCCATACTGTTCTCCATAGTGG + Intergenic
1030709156 7:112729764-112729786 CTCCATACTGTTCTCCATAATGG - Intergenic
1030852528 7:114508492-114508514 AGGCATCCTGTGCTCCAGCTAGG - Intronic
1031068555 7:117135776-117135798 TTCCATGTTGTTCTCCATCAGGG + Intronic
1031386337 7:121156258-121156280 CTCCATACTGTTCTCCATAGCGG - Intronic
1031795012 7:126162147-126162169 CTCCATACTGTTCTCCATAGTGG - Intergenic
1033886085 7:145947629-145947651 ATCTATACTGTTCTCCATAGTGG - Intergenic
1034199361 7:149273321-149273343 CTCCATACTGTTCTCCATAGTGG + Intronic
1034233676 7:149552388-149552410 TTCCATCATGTTCTCTTTCTGGG - Intergenic
1034363702 7:150525655-150525677 TTCCATCCTGTTTTCCATAATGG + Intergenic
1034642207 7:152613222-152613244 CTCCATACTGTTCTCCATAGTGG + Intergenic
1035063220 7:156084818-156084840 CTCCATACTGTTCTCCATTATGG + Intergenic
1037605582 8:20434935-20434957 AGCCTTGCTGTTCTCCCTCTTGG + Intergenic
1039308647 8:36292440-36292462 ATCTATCATCTTCACCATCTTGG - Intergenic
1039622870 8:39015830-39015852 ATGCATCTTGTTCTGCTTCTAGG + Intronic
1039712486 8:40070130-40070152 AGCCATCATGTTGTACATCTTGG + Intergenic
1039934090 8:42025016-42025038 CTCCATACTGTTCTCCATAATGG + Intronic
1039984122 8:42433925-42433947 CTCCATCCTGTTTTCCATAGTGG + Intronic
1040362267 8:46677669-46677691 CTCCATACTGTTCTCCATAGTGG + Intergenic
1040486077 8:47873109-47873131 CTCCATGCTGTTCTCCATACTGG - Intronic
1041379208 8:57235407-57235429 TTCCATCCTGTATTCCATTTGGG + Intergenic
1041819659 8:62016595-62016617 ATCCATACTGTTTTCCATAATGG - Intergenic
1042002658 8:64143627-64143649 CTCCATCCTTTTCTCCATCGTGG - Intergenic
1042335369 8:67624705-67624727 CTCCTTACTGTTCTCCATGTGGG - Intronic
1042837398 8:73091093-73091115 ATCTGTCCTGTTCACCATTTTGG + Intronic
1042917258 8:73887887-73887909 TTCCAGCCTGTTCTCCATAGTGG - Intergenic
1043117110 8:76271320-76271342 AATCCTCCTGTTCTCCATATCGG - Intergenic
1043144113 8:76630219-76630241 CTCCATCCTGTTCTCCATAGTGG - Intergenic
1043637698 8:82407090-82407112 CTCCACCCTTCTCTCCATCTTGG + Intergenic
1043788037 8:84426876-84426898 CTCCATACTGTTCTCCATAACGG - Intronic
1044084742 8:87930536-87930558 CTCCATCATGTTCTACATCTTGG + Intergenic
1044249572 8:89989943-89989965 ATCCATCCTGGTGTCCAGCCCGG - Intronic
1044688496 8:94852784-94852806 CTCCATGTTGTTCTCCATGTTGG + Intronic
1045801054 8:106101586-106101608 CTCCATACTGTTCTCCATAGTGG - Intergenic
1046477700 8:114768754-114768776 TTCCATGCTGTTCTCCATAATGG + Intergenic
1046540869 8:115580817-115580839 CTCCATACTGTTCTCCATAGTGG - Intronic
1047008275 8:120643835-120643857 CTCCATCCTGTTTTCCATAGTGG + Intronic
1048937043 8:139366038-139366060 ATCCATGCTGTCCTCCCTCACGG - Intergenic
1049903904 9:197920-197942 CTCCATACTGTTCTCCATAGTGG + Intergenic
1050566432 9:6889122-6889144 ATCCTTGCTGCTTTCCATCTTGG + Intronic
1050852700 9:10307623-10307645 ATCCATACTGTTTTCCATAATGG + Intronic
1050945821 9:11515744-11515766 TTCCATGCTGTGCTCCATATTGG + Intergenic
1051373854 9:16383923-16383945 CTCCATACTGTTCTCCATAATGG + Intergenic
1051828483 9:21248833-21248855 CTCCATACTGTTCTCCACATTGG - Intergenic
1052311057 9:27069543-27069565 CTCCATACTGTTCTCCATAGTGG + Intergenic
1053221508 9:36316929-36316951 CTCCATCCTGTTCTCTAAGTTGG - Intergenic
1053746912 9:41208221-41208243 CTCCATACTGTTCTCCATAGTGG + Intergenic
1053941451 9:43253539-43253561 CTCCATACTGTTCTCCATAGTGG + Intergenic
1054480373 9:65657138-65657160 CTCCATACTGTTCTCCATAGTGG - Intergenic
1054681432 9:68223060-68223082 CTCCATACTGTTCTCCATAGTGG - Intergenic
1055124871 9:72707329-72707351 CTCCACCCTGTTTTCCATATTGG + Intronic
1056281422 9:85044709-85044731 CTACATTCTGTTCTCCATCCCGG - Intergenic
1056415375 9:86370383-86370405 CTCCATACTGTTCTCCATAGTGG + Intergenic
1058284996 9:103166601-103166623 TTCCATACTGTTCTCCATTGTGG + Intergenic
1058348580 9:103994353-103994375 CTCCATACTGTTCTCCATAGTGG - Intergenic
1058392444 9:104511173-104511195 ATACACCCTGCTCTCCAGCTCGG - Intergenic
1058587394 9:106524871-106524893 ATCCATACTGTTTTCCATAGAGG - Intergenic
1059928163 9:119233516-119233538 ATGCAGCCTGTCCTCCAGCTGGG + Intronic
1062172430 9:135142715-135142737 ATCAATCCTGGTCTCTATTTGGG - Intergenic
1062191058 9:135248110-135248132 ACCCTTCCTTTTCTCCATCTGGG + Intergenic
1202783043 9_KI270718v1_random:19001-19023 CTCCATACTGTTCTCCATAGTGG + Intergenic
1203490628 Un_GL000224v1:101823-101845 AATCATCCTGTTCTCCATATCGG + Intergenic
1203490691 Un_GL000224v1:102361-102383 ATCCATCCTCGTCTCCCGCTTGG + Intergenic
1203503251 Un_KI270741v1:43702-43724 AATCATCCTGTTCTCCATATCGG + Intergenic
1203503315 Un_KI270741v1:44239-44261 ATCCATCCTCGTCTCCCGCTTGG + Intergenic
1186013330 X:5162784-5162806 TTCCATACTGTTCTCCATACTGG + Intergenic
1186650286 X:11552340-11552362 TTCCATACTGTTTTCCATATTGG - Intronic
1186782290 X:12925022-12925044 CTCCAAACTGTTCTCCATCATGG - Intergenic
1186936553 X:14456928-14456950 TTCCATACTGTTCTCCATAGTGG + Intergenic
1187609168 X:20921527-20921549 ATCCATACTGTTCTCCATAGTGG - Intergenic
1187776429 X:22764270-22764292 ATTCTTTCTATTCTCCATCTAGG - Intergenic
1188018689 X:25133800-25133822 ACCCATCTTTTTTTCCATCTCGG + Intergenic
1188068470 X:25690765-25690787 ATCCAAACTGTTCTCCATAGTGG + Intergenic
1188080912 X:25839381-25839403 CTCCATACTGTTCTCCATACAGG - Intergenic
1188850090 X:35121470-35121492 TTTTATACTGTTCTCCATCTTGG - Intergenic
1188996571 X:36893593-36893615 TTCCATACTGTTCTCCATAGTGG - Intergenic
1190311987 X:49123197-49123219 CTCCATCCCGTTCCCCATATCGG + Intronic
1191792449 X:64985268-64985290 ATCCATACTGTTTTCCATAGAGG + Intronic
1192137639 X:68619173-68619195 CTCCATACTGTTTTCCATATTGG + Intergenic
1192638346 X:72842005-72842027 AGCCTTCCTGTTCACCAACTTGG - Intronic
1192643368 X:72878803-72878825 AGCCTTCCTGTTCACCAACTTGG + Intronic
1192722651 X:73716043-73716065 CTCCATGCTGTTCTCCATAGAGG + Intergenic
1192852704 X:74974517-74974539 TTCCAAACTGTTCTCCATATTGG + Intergenic
1192936486 X:75863818-75863840 CTCCATACTCTTCTCCATATTGG + Intergenic
1193037052 X:76962825-76962847 ATCCATACTGTTTTCCATAAAGG + Intergenic
1193153832 X:78152364-78152386 ATCCATACTGTTTTCCATAGTGG + Intergenic
1193546378 X:82835640-82835662 ATCCATACTGTTTTCCATAATGG - Intergenic
1193580288 X:83256247-83256269 ATCCATACTGTTTTCCATAGAGG - Intergenic
1193595994 X:83446112-83446134 ATCCATACTGTTTTCCATAGTGG + Intergenic
1193690829 X:84640409-84640431 ATCCATACTGTTTTCCATAATGG - Intergenic
1193760598 X:85461481-85461503 CTCCATACTGTTCTTCATATTGG + Intergenic
1194173184 X:90614455-90614477 CTCCAACCTGTTCTCCATAGTGG + Intergenic
1194419458 X:93655504-93655526 ATCCAACCTGTTCTCCATAGTGG - Intergenic
1194421754 X:93683589-93683611 CTCCATACTGTTCTCCATAGTGG + Intronic
1194473185 X:94322985-94323007 ATAAATCCAGTTCTCCAGCTTGG + Intergenic
1194876460 X:99194846-99194868 CTCCATACTGTTCTCCATAGTGG + Intergenic
1195091947 X:101468820-101468842 AGCCAAGATGTTCTCCATCTAGG + Intronic
1195406590 X:104521233-104521255 CTCCATACTGTTCTCCATAGTGG + Intergenic
1195501524 X:105606471-105606493 CTCCATACTGTTCTCCATAATGG - Intronic
1195941217 X:110169435-110169457 ATTCATCCTGTTCTCTTTTTGGG + Intronic
1196129389 X:112137816-112137838 CTCCATACTGTTCTCAATATTGG - Intergenic
1196539332 X:116886396-116886418 ATCCATCCATTTATCTATCTAGG + Intergenic
1197126266 X:122949727-122949749 ATCCAAACTGTTCTCCATAGTGG + Intergenic
1197261097 X:124319048-124319070 CTCCATACTGTTCTCCATAGTGG - Intronic
1197371631 X:125633873-125633895 CTCCCTACTGTTCTCCATCGAGG - Intergenic
1197429914 X:126348962-126348984 ATCCAAACTGTTCTCCATAGTGG - Intergenic
1197971835 X:132122444-132122466 TTCTATTCTGTTCTCTATCTTGG + Intronic
1198798843 X:140429139-140429161 CTCCATACTGTTCTCCATAGTGG - Intergenic
1199065975 X:143418604-143418626 AGCCAACTTGTTCACCATCTTGG - Intergenic
1199220829 X:145314194-145314216 ATGCCTTCTTTTCTCCATCTTGG + Intergenic
1199995400 X:153021603-153021625 CTCCCTCCTGTTCACCACCTTGG + Intergenic
1199997476 X:153034771-153034793 AATCCTCCTGTTCTCCATATTGG - Intergenic
1200031577 X:153301046-153301068 CTCCATACTGTTCTCCATAGTGG - Intergenic
1200082671 X:153586429-153586451 ATCCATACTGTTTTCCATAGTGG + Intergenic
1200377299 X:155796677-155796699 ATCCATACTGTTTTCCATAGAGG + Intergenic
1200519400 Y:4192170-4192192 CTCCAACCTGTTCTCCATAGTGG + Intergenic
1201192263 Y:11455047-11455069 CTCCATACTGTTCTCCATAGTGG + Intergenic