ID: 972456187

View in Genome Browser
Species Human (GRCh38)
Location 4:39257964-39257986
Sequence ATTGACTGGGGGGTGACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972456187_972456193 -8 Left 972456187 4:39257964-39257986 CCACATGTCACCCCCCAGTCAAT 0: 1
1: 0
2: 1
3: 22
4: 151
Right 972456193 4:39257979-39258001 CAGTCAATATCCCCCACCAAAGG 0: 1
1: 0
2: 0
3: 14
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972456187 Original CRISPR ATTGACTGGGGGGTGACATG TGG (reversed) Intronic