ID: 972458861

View in Genome Browser
Species Human (GRCh38)
Location 4:39280491-39280513
Sequence CTGGCTAATTATTTTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3956
Summary {0: 1, 1: 2, 2: 48, 3: 266, 4: 3639}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458861_972458871 23 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458871 4:39280537-39280559 CCCCGCTGCTTGGGAGGCTGAGG 0: 19
1: 3545
2: 100052
3: 213765
4: 344317
972458861_972458874 27 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458874 4:39280541-39280563 GCTGCTTGGGAGGCTGAGGCAGG 0: 2562
1: 81904
2: 184201
3: 285827
4: 341214
972458861_972458875 30 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458875 4:39280544-39280566 GCTTGGGAGGCTGAGGCAGGAGG 0: 285
1: 6723
2: 43909
3: 116294
4: 202505
972458861_972458867 14 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG 0: 4
1: 638
2: 17886
3: 104652
4: 249904
972458861_972458866 13 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458866 4:39280527-39280549 CACCTGTAGTCCCCGCTGCTTGG No data
972458861_972458869 17 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458869 4:39280531-39280553 TGTAGTCCCCGCTGCTTGGGAGG 0: 8
1: 1774
2: 49232
3: 164906
4: 239284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458861 Original CRISPR CTGGCTAATTATTTTTTTGT AGG (reversed) Intronic
Too many off-targets to display for this crispr