ID: 972458867

View in Genome Browser
Species Human (GRCh38)
Location 4:39280528-39280550
Sequence ACCTGTAGTCCCCGCTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373084
Summary {0: 4, 1: 638, 2: 17886, 3: 104652, 4: 249904}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458865_972458867 -5 Left 972458865 4:39280510-39280532 CCAGGTATGGTGGCATACACCTG 0: 23
1: 705
2: 10470
3: 44558
4: 118755
Right 972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG 0: 4
1: 638
2: 17886
3: 104652
4: 249904
972458859_972458867 21 Left 972458859 4:39280484-39280506 CCATGTCCCTACAAAAAAATAAT 0: 1
1: 43
2: 839
3: 6488
4: 25490
Right 972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG 0: 4
1: 638
2: 17886
3: 104652
4: 249904
972458860_972458867 15 Left 972458860 4:39280490-39280512 CCCTACAAAAAAATAATTAGCCA 0: 1
1: 1
2: 8
3: 130
4: 826
Right 972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG 0: 4
1: 638
2: 17886
3: 104652
4: 249904
972458861_972458867 14 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458867 4:39280528-39280550 ACCTGTAGTCCCCGCTGCTTGGG 0: 4
1: 638
2: 17886
3: 104652
4: 249904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458867 Original CRISPR ACCTGTAGTCCCCGCTGCTT GGG Intronic
Too many off-targets to display for this crispr