ID: 972458869

View in Genome Browser
Species Human (GRCh38)
Location 4:39280531-39280553
Sequence TGTAGTCCCCGCTGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455204
Summary {0: 8, 1: 1774, 2: 49232, 3: 164906, 4: 239284}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458861_972458869 17 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458869 4:39280531-39280553 TGTAGTCCCCGCTGCTTGGGAGG 0: 8
1: 1774
2: 49232
3: 164906
4: 239284
972458860_972458869 18 Left 972458860 4:39280490-39280512 CCCTACAAAAAAATAATTAGCCA 0: 1
1: 1
2: 8
3: 130
4: 826
Right 972458869 4:39280531-39280553 TGTAGTCCCCGCTGCTTGGGAGG 0: 8
1: 1774
2: 49232
3: 164906
4: 239284
972458859_972458869 24 Left 972458859 4:39280484-39280506 CCATGTCCCTACAAAAAAATAAT 0: 1
1: 43
2: 839
3: 6488
4: 25490
Right 972458869 4:39280531-39280553 TGTAGTCCCCGCTGCTTGGGAGG 0: 8
1: 1774
2: 49232
3: 164906
4: 239284
972458865_972458869 -2 Left 972458865 4:39280510-39280532 CCAGGTATGGTGGCATACACCTG 0: 23
1: 705
2: 10470
3: 44558
4: 118755
Right 972458869 4:39280531-39280553 TGTAGTCCCCGCTGCTTGGGAGG 0: 8
1: 1774
2: 49232
3: 164906
4: 239284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458869 Original CRISPR TGTAGTCCCCGCTGCTTGGG AGG Intronic
Too many off-targets to display for this crispr