ID: 972458871

View in Genome Browser
Species Human (GRCh38)
Location 4:39280537-39280559
Sequence CCCCGCTGCTTGGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661698
Summary {0: 19, 1: 3545, 2: 100052, 3: 213765, 4: 344317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458865_972458871 4 Left 972458865 4:39280510-39280532 CCAGGTATGGTGGCATACACCTG 0: 23
1: 705
2: 10470
3: 44558
4: 118755
Right 972458871 4:39280537-39280559 CCCCGCTGCTTGGGAGGCTGAGG 0: 19
1: 3545
2: 100052
3: 213765
4: 344317
972458859_972458871 30 Left 972458859 4:39280484-39280506 CCATGTCCCTACAAAAAAATAAT 0: 1
1: 43
2: 839
3: 6488
4: 25490
Right 972458871 4:39280537-39280559 CCCCGCTGCTTGGGAGGCTGAGG 0: 19
1: 3545
2: 100052
3: 213765
4: 344317
972458861_972458871 23 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458871 4:39280537-39280559 CCCCGCTGCTTGGGAGGCTGAGG 0: 19
1: 3545
2: 100052
3: 213765
4: 344317
972458860_972458871 24 Left 972458860 4:39280490-39280512 CCCTACAAAAAAATAATTAGCCA 0: 1
1: 1
2: 8
3: 130
4: 826
Right 972458871 4:39280537-39280559 CCCCGCTGCTTGGGAGGCTGAGG 0: 19
1: 3545
2: 100052
3: 213765
4: 344317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458871 Original CRISPR CCCCGCTGCTTGGGAGGCTG AGG Intronic
Too many off-targets to display for this crispr