ID: 972458874

View in Genome Browser
Species Human (GRCh38)
Location 4:39280541-39280563
Sequence GCTGCTTGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 895708
Summary {0: 2562, 1: 81904, 2: 184201, 3: 285827, 4: 341214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458865_972458874 8 Left 972458865 4:39280510-39280532 CCAGGTATGGTGGCATACACCTG 0: 23
1: 705
2: 10470
3: 44558
4: 118755
Right 972458874 4:39280541-39280563 GCTGCTTGGGAGGCTGAGGCAGG 0: 2562
1: 81904
2: 184201
3: 285827
4: 341214
972458860_972458874 28 Left 972458860 4:39280490-39280512 CCCTACAAAAAAATAATTAGCCA 0: 1
1: 1
2: 8
3: 130
4: 826
Right 972458874 4:39280541-39280563 GCTGCTTGGGAGGCTGAGGCAGG 0: 2562
1: 81904
2: 184201
3: 285827
4: 341214
972458861_972458874 27 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458874 4:39280541-39280563 GCTGCTTGGGAGGCTGAGGCAGG 0: 2562
1: 81904
2: 184201
3: 285827
4: 341214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458874 Original CRISPR GCTGCTTGGGAGGCTGAGGC AGG Intronic
Too many off-targets to display for this crispr