ID: 972458875

View in Genome Browser
Species Human (GRCh38)
Location 4:39280544-39280566
Sequence GCTTGGGAGGCTGAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369716
Summary {0: 285, 1: 6723, 2: 43909, 3: 116294, 4: 202505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972458865_972458875 11 Left 972458865 4:39280510-39280532 CCAGGTATGGTGGCATACACCTG 0: 23
1: 705
2: 10470
3: 44558
4: 118755
Right 972458875 4:39280544-39280566 GCTTGGGAGGCTGAGGCAGGAGG 0: 285
1: 6723
2: 43909
3: 116294
4: 202505
972458861_972458875 30 Left 972458861 4:39280491-39280513 CCTACAAAAAAATAATTAGCCAG 0: 1
1: 2
2: 48
3: 266
4: 3639
Right 972458875 4:39280544-39280566 GCTTGGGAGGCTGAGGCAGGAGG 0: 285
1: 6723
2: 43909
3: 116294
4: 202505
972458868_972458875 -8 Left 972458868 4:39280529-39280551 CCTGTAGTCCCCGCTGCTTGGGA 0: 7
1: 1828
2: 49074
3: 164164
4: 238496
Right 972458875 4:39280544-39280566 GCTTGGGAGGCTGAGGCAGGAGG 0: 285
1: 6723
2: 43909
3: 116294
4: 202505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972458875 Original CRISPR GCTTGGGAGGCTGAGGCAGG AGG Intronic
Too many off-targets to display for this crispr