ID: 972463164

View in Genome Browser
Species Human (GRCh38)
Location 4:39325676-39325698
Sequence GAAGATTCACAGATGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972463164_972463171 29 Left 972463164 4:39325676-39325698 CCCAGCCTCATCTGTGAATCTTC 0: 1
1: 0
2: 0
3: 23
4: 264
Right 972463171 4:39325728-39325750 AAAAGAACTTGCATGTTTCAAGG 0: 1
1: 0
2: 3
3: 19
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972463164 Original CRISPR GAAGATTCACAGATGAGGCT GGG (reversed) Intronic
900199025 1:1394452-1394474 GAAAATTAACTGTTGAGGCTGGG + Intronic
901269511 1:7941045-7941067 GATGTGTCACAGATGACGCTGGG + Intronic
902415283 1:16235017-16235039 TAAGAGCCACAGATGAGGCCGGG - Intronic
902711185 1:18241089-18241111 GAACATTCAAAGGTGAGGCCAGG + Intronic
904119910 1:28191174-28191196 GAAGACTCAGAGATGTGGCCAGG + Intronic
904381535 1:30114491-30114513 GAACATTCACAGAATTGGCTGGG - Intergenic
905233262 1:36528943-36528965 GAAGTCTGACAAATGAGGCTGGG - Intergenic
905364225 1:37440115-37440137 GAAGATTTGCTGAGGAGGCTGGG + Intergenic
906971213 1:50516279-50516301 GAAGAATAAGAGATGAGGATAGG - Intronic
907398742 1:54210974-54210996 GAGGAGGCAAAGATGAGGCTGGG - Intronic
907750584 1:57259275-57259297 GAAGACTCACAGTTGAGACCAGG + Intronic
909649074 1:77953192-77953214 TAAAATTAACAGGTGAGGCTGGG + Intronic
909932525 1:81513925-81513947 GAAGATTCACAGAAGATGACAGG - Intronic
910094541 1:83505947-83505969 GAAGATTTGTAGATGAGGGTAGG - Intergenic
910167725 1:84345304-84345326 GGAGATTTTCATATGAGGCTGGG + Intronic
910257688 1:85264754-85264776 CAAGATTCACTCATCAGGCTGGG + Intergenic
910532381 1:88252509-88252531 CATTATTCAGAGATGAGGCTGGG + Intergenic
911622259 1:100078772-100078794 GAAAATTTACTGATGAGGCTGGG + Intronic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
916811558 1:168309999-168310021 CAAAATTAAAAGATGAGGCTTGG + Intronic
918340792 1:183566673-183566695 GAAGAGTCACAGAGGTGGGTGGG + Intronic
918619668 1:186588636-186588658 CAAAATTCACATAAGAGGCTGGG + Intergenic
921510917 1:216028090-216028112 AAAGATTCACAGAAGTGGCCGGG + Intronic
921650521 1:217672915-217672937 GAAGATACAAAGATGAAGATAGG - Intronic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922623056 1:227006135-227006157 GAAGATGCTTACATGAGGCTGGG - Intronic
922928288 1:229368845-229368867 AAAGAAGCAAAGATGAGGCTGGG - Intergenic
923438086 1:233987766-233987788 GAAGATTAAAAGATTAGTCTAGG - Intronic
923462326 1:234217911-234217933 GAGGCATCACAGCTGAGGCTGGG + Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1065495866 10:26327547-26327569 GAAAAATCACAGAAGAGGTTTGG - Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1068226049 10:54108216-54108238 AAAGAGTCACTGATGAGGATAGG + Intronic
1069049691 10:63779567-63779589 TAAAATTCTCACATGAGGCTGGG + Intergenic
1069862021 10:71477468-71477490 GAAGATTCAAAGAGGAGCCTGGG - Intronic
1070353881 10:75620145-75620167 GAACATTCACAGACCAGGCCTGG + Intronic
1071072246 10:81708326-81708348 GAAGCTCCACTGATGAGGCGTGG + Intergenic
1071297051 10:84228999-84229021 GAAGGTTGACAGATGAGTTTTGG + Intergenic
1072531030 10:96319516-96319538 GAAGGATCAGAGATCAGGCTAGG - Intronic
1072926587 10:99621377-99621399 GATGATTCACAGATGACGGCCGG + Intergenic
1073507774 10:104016021-104016043 GAAATTTTACAGTTGAGGCTGGG + Intronic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1074310281 10:112316495-112316517 TAAAATTAACAAATGAGGCTGGG - Intergenic
1074589646 10:114800615-114800637 GAAAATCCACATATAAGGCTGGG + Intergenic
1075864619 10:125706874-125706896 GAATATTCCCAGATGAGAATGGG + Intergenic
1079571042 11:21943438-21943460 GAAGAATGAAAGATGAGGCCGGG - Intergenic
1080769732 11:35329582-35329604 GAATATTCAGGGATGGGGCTTGG - Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1087187148 11:95211872-95211894 AAAGATTTACAGAATAGGCTGGG + Intronic
1087950689 11:104217992-104218014 GAAGACTCATAGAGGAGTCTTGG + Intergenic
1089362487 11:117900283-117900305 GAAGCTTCACAGAGGAGGTCAGG - Intergenic
1090085005 11:123642830-123642852 GAAGAGGCACAGAGGAGGGTAGG + Intronic
1092966432 12:13648012-13648034 GAAAATTCATTGGTGAGGCTTGG + Intronic
1096808116 12:54152712-54152734 GAAGCTTCAGAGAAGAGGCTGGG + Intergenic
1097371932 12:58794557-58794579 GAATATGTAAAGATGAGGCTGGG + Intronic
1097441079 12:59609488-59609510 GAAGATTGAGAGATGTGGGTCGG + Intronic
1098097134 12:66970374-66970396 AAAATTACACAGATGAGGCTGGG - Intergenic
1098724214 12:73941883-73941905 GAAGAAGCACATATGAGGTTGGG + Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1101330920 12:103757381-103757403 AAATATTCACTGATCAGGCTGGG - Intronic
1101346019 12:103886740-103886762 GAACATTCTCAGACTAGGCTAGG - Intergenic
1102799378 12:115718099-115718121 GAGAACTCACAGATCAGGCTAGG + Intergenic
1105019562 12:132807082-132807104 GAGGTTTCACAGATGTGGTTGGG - Intronic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1108454268 13:50597346-50597368 GAGGCTTCAGAGAGGAGGCTGGG + Intronic
1109200386 13:59424143-59424165 GAAAATTCTCAGACAAGGCTAGG + Intergenic
1110632742 13:77728276-77728298 GTAAATTCACGCATGAGGCTGGG + Intronic
1110829171 13:80010886-80010908 GAATATGCACAGATGAGCATAGG - Intergenic
1112215355 13:97425164-97425186 GACTATTCACTGATGAGACTTGG + Intergenic
1117373944 14:55103868-55103890 GAAGACTCACAGACAAGCCTTGG + Intergenic
1117792021 14:59351131-59351153 GAAGAGTCAAAGATGACGCCTGG - Intronic
1118235128 14:63996234-63996256 GAAGAATCCCAGATGGGGCTTGG - Intronic
1118352733 14:64985132-64985154 AAAATTTCAAAGATGAGGCTGGG - Intronic
1119077427 14:71656067-71656089 GAAGTTTCAGAGATGAAACTAGG - Intronic
1119647158 14:76356150-76356172 GAAGAGTCAGAGAAGGGGCTAGG + Intronic
1119766036 14:77188112-77188134 GAAGATGAACAGATGAGGATAGG - Intronic
1121176939 14:91897510-91897532 GAAGAATCACTGGAGAGGCTTGG + Intronic
1121722812 14:96122765-96122787 CATGATTCACAGAAGGGGCTGGG + Intergenic
1122194483 14:100074813-100074835 GAAGTTTCACACAGGAGGCGAGG + Intronic
1125645927 15:41272714-41272736 TAAGATTGACAGGTGTGGCTGGG - Intronic
1125825678 15:42674325-42674347 GAAGTGGTACAGATGAGGCTGGG + Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128190650 15:65692096-65692118 GAAGATTCACAATTTTGGCTGGG - Intronic
1129840365 15:78739810-78739832 CAAGTTTCATAGCTGAGGCTGGG + Intergenic
1130386529 15:83416925-83416947 AAAGAATCACACAAGAGGCTGGG - Intergenic
1131085040 15:89568756-89568778 GAAGATGCAGAGGTGAGTCTGGG - Intergenic
1132770311 16:1558582-1558604 GAAGATGCCCAGGTGAGGATGGG - Intronic
1136484957 16:30565731-30565753 GAAGATTAACAGATGGGCTTAGG - Intergenic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1137922578 16:52505486-52505508 GAATAATTACAGATGATGCTAGG + Intronic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1140677330 16:77345359-77345381 GAAGAGTCAAAGATGACTCTAGG - Intronic
1140835129 16:78786937-78786959 GAAGAGTTAGAGATGAGCCTGGG + Intronic
1143319695 17:6060050-6060072 GAAGATTCAAGGATGAGGACGGG - Intronic
1146767531 17:35536878-35536900 GAATCTTCACAGGCGAGGCTGGG + Intronic
1147015022 17:37484853-37484875 TAAGATTTACAGAGCAGGCTGGG + Intergenic
1147492215 17:40880299-40880321 GCACATTCTCAGATAAGGCTGGG + Intronic
1147888256 17:43698954-43698976 GATGGTTCAGAGAGGAGGCTGGG - Intergenic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1150283383 17:63942118-63942140 GATGACTGACAGGTGAGGCTGGG + Intronic
1150918577 17:69460420-69460442 GAGTATTGAGAGATGAGGCTGGG + Intronic
1151168147 17:72222489-72222511 CAAGAATCACATATGAGGCCAGG - Intergenic
1152143073 17:78549938-78549960 GAACAGCCACAGAGGAGGCTGGG + Intronic
1154093524 18:11387739-11387761 GAAATTTCAGAGATGAGCCTGGG - Intergenic
1155001101 18:21687504-21687526 GAAGTTTAACAGAGGCGGCTGGG - Intronic
1158661214 18:59389703-59389725 GAAGATTTGCAGAGGAGGCCTGG - Intergenic
1162062020 19:8101765-8101787 GAAGATTCACAGGAGTAGCTGGG - Intronic
1162822945 19:13234527-13234549 GAAGATTCAGAGATAATGCCTGG + Intronic
1163052385 19:14694175-14694197 AAGGATTCTCAGATGAGGCCGGG + Intronic
1165798646 19:38534304-38534326 TAAAAATCACAGATGTGGCTGGG - Intronic
1167167975 19:47812299-47812321 AAAGAATCACAGAATAGGCTGGG + Intronic
1167702619 19:51059110-51059132 AAAGATACAAACATGAGGCTGGG + Intronic
925415878 2:3669830-3669852 GAAGAGCCAGAGCTGAGGCTTGG + Intronic
928234832 2:29530428-29530450 GAGGATTCACTGATGTGGCTGGG - Intronic
928461518 2:31477585-31477607 AAAGATTCAAAGCTCAGGCTGGG - Intergenic
928691779 2:33807353-33807375 GAAGAATCCCAGTTGCGGCTGGG + Intergenic
929570832 2:43021986-43022008 GGTGATTCACAGTTTAGGCTGGG - Intergenic
930288958 2:49468877-49468899 AAAGAAGCACTGATGAGGCTAGG - Intergenic
932217016 2:69972969-69972991 AAAGATTCCCAGAAGAGGGTGGG - Intergenic
932623254 2:73279173-73279195 GAGGACTCAAGGATGAGGCTCGG + Intronic
935390541 2:102547860-102547882 GAAGATTCCCAGATGAAATTAGG + Intergenic
939152232 2:138486706-138486728 GAACATTCAGAGAAAAGGCTTGG - Intergenic
940247603 2:151636482-151636504 GAAGACTCAAAAATGAGGCTAGG + Intronic
940576642 2:155515438-155515460 AAAGATTCAGACATGAGGCTTGG - Intergenic
944719351 2:202407376-202407398 GAAGAATAACAGCTGAGGCCAGG - Intronic
945492345 2:210471338-210471360 GAAAAATCAAAGAAGAGGCTGGG - Intronic
945505596 2:210636735-210636757 AAGGCTTCACAAATGAGGCTTGG + Intronic
945826463 2:214725930-214725952 GACGATTCACAGGTGAGAGTGGG - Exonic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947629044 2:231639920-231639942 TAAAATTCACAGAAGAGGCCGGG - Intergenic
948387663 2:237591613-237591635 GAAGAATCTCAGAGGAGGCTTGG - Intronic
948985723 2:241521774-241521796 TTAGAATCACAGAAGAGGCTAGG - Intergenic
1168791665 20:581628-581650 GAAGATACATAGATGATGATAGG - Intergenic
1168995548 20:2130152-2130174 GGAGATACACAAATGAGTCTTGG + Intronic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1171485076 20:25480448-25480470 GAACACTCAGAGATGAGACTAGG + Intronic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172336915 20:34124226-34124248 GAAAATTCATAGATATGGCTGGG - Intergenic
1172779270 20:37426164-37426186 GAAGAGTCAGAGATGAGTCCGGG - Intergenic
1174397663 20:50257944-50257966 GAAAAATCACAGATGTGGCGGGG + Intergenic
1174641702 20:52050040-52050062 GAAGATTAAAAGAGGAGGCCGGG - Intergenic
1175182962 20:57161470-57161492 GAAGATTAACAAAGTAGGCTGGG - Intergenic
1175921167 20:62451216-62451238 GAAGAGCCACAGCTGAGGCTCGG - Intergenic
1178342903 21:31801211-31801233 TAAGATATACAAATGAGGCTGGG + Intergenic
1178934324 21:36848561-36848583 AAAGCTTTACAGTTGAGGCTGGG - Intronic
1179641795 21:42752558-42752580 CAAAAATCTCAGATGAGGCTGGG - Intronic
1179797649 21:43794676-43794698 GTTGATTCACGGGTGAGGCTTGG + Intronic
1180906550 22:19416902-19416924 GAAGATATACAAATGAGGCACGG + Intronic
1181012443 22:20049911-20049933 GAAGAAACACTGTTGAGGCTGGG + Intronic
1183472734 22:38018158-38018180 GAAAGTTCACAGATGAGCCCTGG - Intronic
1183474787 22:38030214-38030236 GAAGATCCCCAGATAGGGCTGGG + Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
949132308 3:518486-518508 GATGATTCACTGATGAGATTTGG - Intergenic
949753309 3:7379386-7379408 TAAAATTCACAGAAGAGTCTGGG - Intronic
949925945 3:9041803-9041825 TAAGAGAAACAGATGAGGCTGGG + Intronic
950203400 3:11060626-11060648 TCAGTTTCACAGATGAGGCATGG + Intergenic
950287193 3:11754211-11754233 GGAGATTGACAGATGATGCTAGG - Intergenic
953298702 3:41750061-41750083 TGAGATTCTCAGTTGAGGCTCGG - Intronic
953455440 3:43037012-43037034 GAAGACTAACACATGAGGCAAGG + Intronic
953506928 3:43495573-43495595 GCAGCTTCACAGATGAGGCATGG + Intronic
953558092 3:43962832-43962854 GAAGAGTCACAGCTCTGGCTGGG + Intergenic
953877401 3:46674141-46674163 GAATATCCACTGCTGAGGCTGGG - Intronic
954818510 3:53303774-53303796 GCAGAGTGACAGATGAGGCCTGG + Intronic
954853831 3:53625960-53625982 GAAAATTTACAGACTAGGCTGGG + Intronic
954965221 3:54604554-54604576 GAAGAAACAAAGATGATGCTAGG - Intronic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
956657823 3:71568940-71568962 GAAAATTCAGAGAACAGGCTGGG - Intronic
957524640 3:81364004-81364026 AAAGATTTACAGATAAGCCTTGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959000617 3:100959665-100959687 GAAGATCCAAAGCTGAGGGTAGG + Intronic
960039442 3:113134665-113134687 GAAGATTCAAAAATGTGACTTGG - Intergenic
963244947 3:143049108-143049130 AAAGATTCAAAAATTAGGCTTGG + Intronic
964684008 3:159375256-159375278 GAAGATGCTCAGATGAGCCCAGG + Intronic
966350066 3:179024055-179024077 GAATATTCAAATATGAGGCTTGG + Exonic
966745058 3:183267452-183267474 GAGGTGTCACAGCTGAGGCTAGG + Intronic
968837876 4:2978932-2978954 GAAAATACACAAATTAGGCTGGG + Intronic
970906034 4:21217612-21217634 GAAGATTAAAAGATGAGTTTTGG + Intronic
971176862 4:24290382-24290404 GGATATTCACTGATGAAGCTGGG - Intergenic
971620067 4:28844719-28844741 CAATATTCACAAATGAGGCCAGG + Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
973008297 4:45041858-45041880 GAAGAGTCACACATGTGACTTGG + Intergenic
975086740 4:70350443-70350465 GAATATTCACAGATTGGTCTAGG - Intergenic
978463711 4:108985020-108985042 AATGACTCTCAGATGAGGCTAGG + Intronic
979440015 4:120740534-120740556 GAGGAGTCACAGATGAATCTAGG - Intronic
981750698 4:148090545-148090567 GCAGGTTCACAGATGTGCCTGGG - Intronic
985480198 5:105250-105272 GTGGATTCACAGCTGTGGCTGGG + Intergenic
985983773 5:3495526-3495548 AAATATTCACAGATGAGACAAGG - Intergenic
986642798 5:9888769-9888791 GATGACTCACAGAGGAGGCAAGG + Intergenic
988337967 5:29930625-29930647 GGAGACTCACAGAAGAGGTTAGG - Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
990936195 5:61152218-61152240 AAATATTAATAGATGAGGCTTGG + Intronic
992909784 5:81384743-81384765 AAACATTTACAGATGATGCTTGG + Intronic
997227594 5:132220782-132220804 AAAGAATCACAGATGGGGTTTGG + Intronic
997228928 5:132228763-132228785 GAAGGTTCACAGAGCAGGCGTGG - Intronic
997393113 5:133532979-133533001 GAAGTTTCACAGCTGAGACAGGG - Intronic
997717458 5:136052782-136052804 GAGGACCCTCAGATGAGGCTGGG - Intronic
997784862 5:136700927-136700949 GAAGTATCTGAGATGAGGCTTGG - Intergenic
997813812 5:136997184-136997206 GAAGAAGCAGATATGAGGCTGGG - Intronic
998102027 5:139442414-139442436 GAAGATGGACAGCTGAGGGTGGG + Intronic
998308795 5:141105236-141105258 AAAGATTCACATATTTGGCTGGG - Intronic
998414897 5:141938933-141938955 GTAGCCTCACAGATGAGTCTTGG + Exonic
1000157027 5:158562399-158562421 GAAGATTCTCAGCTGGTGCTTGG - Intergenic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1001213061 5:169828750-169828772 AGAGATTCTCAGATGAGGCGTGG - Intronic
1002891877 6:1340410-1340432 GAAAATACGCAGCTGAGGCTAGG - Intergenic
1005471428 6:26165627-26165649 GAACACCCACAGCTGAGGCTTGG + Intronic
1006110291 6:31740397-31740419 AACGATTCACAGAGGAGGCCGGG - Intronic
1010825180 6:80464420-80464442 AAAGATTTAAAGATGAGGCTGGG - Intergenic
1013350564 6:109302070-109302092 CATGCTTCACAGATGAGGGTGGG + Intergenic
1013736657 6:113235130-113235152 GAAGCTTCACAGGTGAGGGGAGG - Intergenic
1014036625 6:116774022-116774044 CAAGATTCATAGAAGGGGCTGGG + Intergenic
1015050724 6:128836288-128836310 AAAGATTACCAGAAGAGGCTGGG - Intergenic
1015153325 6:130063090-130063112 GAAGATTCAGAGAAGAGGCCTGG + Intronic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1015716625 6:136199383-136199405 GAAGATTAAGAGTTGAGGCATGG + Intergenic
1015826066 6:137313086-137313108 GAAGATTAACAAAAGAGGCTGGG - Intergenic
1016640154 6:146338930-146338952 GAAGATTTATGGAGGAGGCTGGG - Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1018127065 6:160691968-160691990 GTTGATTTACAGTTGAGGCTTGG + Intergenic
1018650847 6:165990018-165990040 AAAGGTCCACAGATGAGCCTTGG - Intergenic
1021164759 7:17323798-17323820 GAAGATCCTCAGTTGGGGCTAGG - Intronic
1021904286 7:25317737-25317759 GAAGATACACAGTTGAGAGTGGG + Intergenic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022498657 7:30868943-30868965 GAAAACTCACAGAATAGGCTTGG - Intronic
1023441014 7:40184979-40185001 GAAGATTCTCTGATGAGCATGGG + Intronic
1026522256 7:71127761-71127783 GCAGATTCAATGGTGAGGCTAGG + Intergenic
1027579039 7:79969677-79969699 GAAGATTCACTGTTAGGGCTGGG - Intergenic
1028108946 7:86915602-86915624 GAAAATTCAGAGTTTAGGCTTGG - Intronic
1029013549 7:97289156-97289178 GGAGATTCACAAAACAGGCTGGG + Intergenic
1029412344 7:100422482-100422504 GAATGTTCGCAGATGAGTCTTGG - Intronic
1030452174 7:109725687-109725709 GAAGATACACAGATGAAAATTGG - Intergenic
1030659128 7:112201539-112201561 ACAGATTCACAGATGAGTCATGG - Intronic
1030780880 7:113598310-113598332 GAAGATTTACATCTGAGTCTTGG - Intergenic
1031211528 7:118834837-118834859 AAAAATTGTCAGATGAGGCTGGG + Intergenic
1031226313 7:119042177-119042199 TAAGGTACACAGATGAGACTCGG + Intergenic
1031600283 7:123699696-123699718 GAAGATTCAAGAATGAGGATAGG + Intronic
1032332164 7:130990696-130990718 CAAGATTCACAGAGGAGGTTGGG - Intergenic
1033463088 7:141565019-141565041 GAAGAGTAACAAAGGAGGCTGGG - Intronic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1034281869 7:149860200-149860222 GAACTTTCACAGATGAGAATGGG + Intronic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1035243750 7:157549065-157549087 GGAGATTGACAGATGTGGCATGG - Intronic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1038719523 8:30021459-30021481 AAAGAAACACAGAGGAGGCTGGG + Intergenic
1038783293 8:30587575-30587597 GAAGATATACAAATGAGGCCAGG + Intronic
1040082020 8:43295027-43295049 GAAAGTTCACAGAAGAGGCCAGG - Intergenic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1042477745 8:69267903-69267925 GAAGGGACACAGATCAGGCTGGG - Intergenic
1043631250 8:82337477-82337499 GCAGGTACACAGATGAGCCTTGG - Intergenic
1044122489 8:88414790-88414812 GAGGAATCACAGATGAACCTTGG + Intergenic
1044197368 8:89393913-89393935 GAAGATTAATTGATGAGGCCAGG + Intergenic
1044277814 8:90322640-90322662 GGTGATTCTCAGGTGAGGCTTGG - Intergenic
1044516809 8:93148447-93148469 AAAGATTCAGAGATGTAGCTGGG - Intronic
1045370541 8:101518108-101518130 GAAGATTCACAGAAGAGTTTAGG - Intronic
1047172084 8:122503489-122503511 ACAGATTAACAGATGAGGGTGGG - Intergenic
1050609404 9:7336066-7336088 AAAGATATCCAGATGAGGCTTGG + Intergenic
1050991154 9:12154052-12154074 GAACATTGAAAGATGAGTCTAGG + Intergenic
1051340080 9:16102917-16102939 GAAGATTAAAAGCTGAGGGTGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055966975 9:81874840-81874862 GAAGATTCAAGGATGCTGCTTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057275615 9:93674649-93674671 TAGGCTGCACAGATGAGGCTGGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057787346 9:98096811-98096833 GAAGATGGACAGAGGAGGCCAGG - Intronic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1059437976 9:114287868-114287890 CCCAATTCACAGATGAGGCTCGG - Intronic
1059563930 9:115363685-115363707 GAACATTAAGAGATGAGGGTAGG - Intronic
1059636582 9:116177485-116177507 GATGATTCAAATATGAGGTTAGG + Intronic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1060647687 9:125295725-125295747 AAAAATTAACACATGAGGCTGGG - Intronic
1060931412 9:127491707-127491729 GGAGTTACACAGATGCGGCTGGG - Intronic
1062461393 9:136663992-136664014 GCAGATCCAGAGATGAGGCCAGG + Intronic
1190421093 X:50285322-50285344 AAAGACTCACAGGTGAGGATAGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192805784 X:74507249-74507271 AAAAAATCACAGATGAGGCTGGG - Intronic
1193234011 X:79084397-79084419 AAAGGTTCACAGATGTGCCTTGG + Intergenic
1193763698 X:85498596-85498618 GAAGACTCAAAGATGACACTCGG - Intergenic
1194699491 X:97096349-97096371 GAAGTGACACAGATCAGGCTAGG - Intronic
1196063666 X:111438889-111438911 GAATATTAACAAATAAGGCTGGG - Intergenic
1196841945 X:119867131-119867153 CAAAATTCACAGAAAAGGCTGGG + Intergenic
1197013451 X:121594535-121594557 GAAGCTTTACAGATGTTGCTTGG + Intergenic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic