ID: 972463648

View in Genome Browser
Species Human (GRCh38)
Location 4:39330537-39330559
Sequence ACTCCTGGTCTAGCTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972463648_972463653 -2 Left 972463648 4:39330537-39330559 CCACAATCAGCTAGACCAGGAGT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 972463653 4:39330558-39330580 GTGAGCACTTCAGCAAGGTGGGG 0: 1
1: 0
2: 3
3: 20
4: 206
972463648_972463650 -7 Left 972463648 4:39330537-39330559 CCACAATCAGCTAGACCAGGAGT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 972463650 4:39330553-39330575 CAGGAGTGAGCACTTCAGCAAGG 0: 1
1: 0
2: 1
3: 25
4: 241
972463648_972463652 -3 Left 972463648 4:39330537-39330559 CCACAATCAGCTAGACCAGGAGT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 972463652 4:39330557-39330579 AGTGAGCACTTCAGCAAGGTGGG 0: 1
1: 0
2: 5
3: 13
4: 161
972463648_972463651 -4 Left 972463648 4:39330537-39330559 CCACAATCAGCTAGACCAGGAGT 0: 1
1: 0
2: 0
3: 7
4: 82
Right 972463651 4:39330556-39330578 GAGTGAGCACTTCAGCAAGGTGG 0: 1
1: 0
2: 3
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972463648 Original CRISPR ACTCCTGGTCTAGCTGATTG TGG (reversed) Intronic
902318949 1:15646143-15646165 TCTCCTGGCCTAGCAGAGTGCGG + Intronic
903534067 1:24054954-24054976 ATTCCTGGTCTGGCTGGGTGTGG - Intergenic
904303208 1:29569483-29569505 ACTCCTGGTCTGGATGATCTTGG + Intergenic
908395383 1:63720503-63720525 ACTCCTGGTTCATGTGATTGTGG + Intergenic
910181169 1:84484960-84484982 ACTTCTGGTCTGGCTAAGTGCGG - Intronic
917704791 1:177621408-177621430 AAAGCTGGTCTAGCTGATTCAGG + Intergenic
919540356 1:198837632-198837654 ACTTCTGGTTTATATGATTGAGG + Intergenic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1068236255 10:54236843-54236865 ATTCCTGGCCTATCTGATGGCGG + Exonic
1068752251 10:60608309-60608331 CTTCCTGATGTAGCTGATTGTGG - Intronic
1068764502 10:60748092-60748114 ACTCCAGGTGAATCTGATTGAGG - Intergenic
1070592698 10:77811914-77811936 ACTCCCGGTCCAGGTGAGTGCGG - Exonic
1073577678 10:104639851-104639873 ACTCCTGCAGTAGCGGATTGGGG + Intergenic
1074224833 10:111474186-111474208 GCTCCTGGTCTTACTGATGGAGG - Intergenic
1074816140 10:117142063-117142085 ACTCATCTACTAGCTGATTGGGG + Intergenic
1074946729 10:118287167-118287189 ATTACTGGTGTAGCTGTTTGAGG + Intergenic
1078148733 11:8740915-8740937 ACTCTTGGACTTGCTGACTGAGG - Intronic
1080116916 11:28631618-28631640 TCTCCTGGTCAGGCTGATGGGGG + Intergenic
1080367284 11:31590296-31590318 AGTCCTGGTCTAGTTTTTTGTGG - Intronic
1084471330 11:69360849-69360871 ACTCCTTGTCCATCTGATTGAGG - Intronic
1089081406 11:115779115-115779137 AGTCCTGGCCTAGAAGATTGTGG - Intergenic
1098338818 12:69430930-69430952 AATCCTGGTCTAGTTAATTGTGG - Intergenic
1098785034 12:74742950-74742972 AATCCAGGTCTATCTGATTCTGG + Intergenic
1101090836 12:101283327-101283349 AAGCCTAGTCTAGCTTATTGGGG - Intronic
1101413660 12:104490182-104490204 TGTCCTGGCCTAGCTGGTTGAGG + Intronic
1104464939 12:128982599-128982621 ACAGCTGGTCTTGTTGATTGAGG + Intronic
1104998278 12:132672743-132672765 ACTCCTGCTCTTGCTTGTTGGGG + Exonic
1113455570 13:110446271-110446293 GCTGCTGGTCTAGCTGAGAGGGG + Intronic
1116818096 14:49601777-49601799 ACTCCTCATCTAGCTGGTGGTGG - Intronic
1118785943 14:69045329-69045351 ATTCCAGGTCTGGCTGACTGCGG - Intergenic
1126696907 15:51334023-51334045 AAGCCTGGTCTAGCAGATTAAGG - Intronic
1134689701 16:16183067-16183089 AGTCCTTGTCTAGCTATTTGAGG + Intronic
1142139659 16:88467228-88467250 GCTCCTGGTCTGGGTGACTGTGG - Intronic
1144633189 17:16886169-16886191 ATAACTGGTCTAGCTGTTTGTGG + Intergenic
1148580158 17:48738190-48738212 ACTGCTGGTCTAGCTCTGTGAGG + Intergenic
1149535489 17:57430463-57430485 ACTCCTGGTCTGGCAAATGGGGG + Intronic
1156291936 18:35755081-35755103 GTTCCTGGTCTAGCTGACAGGGG - Intergenic
1162105233 19:8366216-8366238 CCTCATGGTCTAGGTGCTTGTGG - Exonic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1167604931 19:50476577-50476599 GCTCCTGCTCTTGCTGATGGCGG + Exonic
937696535 2:124814463-124814485 ACTCCTGGCCTAGCACAATGTGG + Intronic
941274227 2:163470497-163470519 TCTACTGGTCTAGCTGAAGGTGG + Intergenic
941722350 2:168825290-168825312 ACTCATGATCTGGGTGATTGGGG - Intronic
941885614 2:170524330-170524352 ATTCCTCGACTAGCTGATGGGGG - Intronic
945208072 2:207353297-207353319 ACTCATGGTCAAGCTGACAGTGG - Intergenic
947064003 2:226199415-226199437 ATTTCTGGTTTAGCTGATTGAGG + Intergenic
949049886 2:241891874-241891896 ACTCCCGGCCGAGCTGCTTGGGG - Intergenic
1172199197 20:33113317-33113339 ACTCCTGCTCTGACTGATGGAGG + Intergenic
1174124976 20:48297615-48297637 ACCATTGGTCTAGCTGGTTGGGG - Intergenic
1174323100 20:49757975-49757997 ACACCTGTCCTAGCTGCTTGGGG - Intergenic
1181581005 22:23827980-23828002 ACTCCTGGTCTAGCTCTCTGTGG - Intronic
1183122395 22:35740058-35740080 ACTCCTAGTGCATCTGATTGAGG + Intronic
949928667 3:9061197-9061219 ACTCCAGGTCTAGGTGACAGAGG + Intronic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
952326043 3:32321529-32321551 ACTCCTGATTTAGCAGATTGTGG - Intronic
954883699 3:53853750-53853772 ACTGCTGGTCTTGGAGATTGTGG + Intronic
956529504 3:70202064-70202086 ACTAGTGGTCTATCTGATAGTGG + Intergenic
956598348 3:70993218-70993240 ATTCCTGGTGTAGATGATTTGGG + Intronic
956853468 3:73253854-73253876 ACTTCTTGGCTAGATGATTGGGG + Intergenic
957745093 3:84330345-84330367 ACTCCTGGTGTAGCTATTTTTGG + Intergenic
960607681 3:119524706-119524728 ACTTCTGGTCTAGTGAATTGTGG + Exonic
966296401 3:178428672-178428694 AATCCAAATCTAGCTGATTGTGG - Intronic
969713946 4:8859592-8859614 ACCCCTGGTCTGGGTGAGTGGGG - Intronic
972463648 4:39330537-39330559 ACTCCTGGTCTAGCTGATTGTGG - Intronic
978389247 4:108207151-108207173 ACTCCTGCTCCAGTTGATGGGGG + Intergenic
983177784 4:164611605-164611627 CCTCCTGCTCTAGGTGAATGTGG - Intergenic
983535667 4:168854470-168854492 ACTTCTGATCTAACTCATTGGGG - Intronic
983555145 4:169053205-169053227 ACCCCTTGTCTGGGTGATTGCGG + Intergenic
984024234 4:174523311-174523333 ACTCCAGGGCTAGCTGTATGCGG + Intergenic
991080876 5:62597876-62597898 ACTCCAGGATTAGCTGACTGTGG + Intronic
991978761 5:72210310-72210332 ACTGCTGCCCTAACTGATTGGGG + Intergenic
995367439 5:111378925-111378947 TCTCCTGGCCTAGCTAATTTGGG + Intronic
997370711 5:133357894-133357916 ACTCCTGTTCTAGCTGAGTCTGG + Intronic
999931730 5:156440506-156440528 ACTCCAGGTTTAACTTATTGAGG + Intronic
1000013514 5:157256660-157256682 ACTCCCTGTCTTGCTGAATGAGG - Intergenic
1003150161 6:3541294-3541316 TCTCCTGGTTTAGCTGACAGAGG + Intergenic
1007820569 6:44557891-44557913 CCTCCTGGCTTATCTGATTGTGG - Intergenic
1016030839 6:139336243-139336265 CCTCCTGGTCTATCTCATTTGGG - Intergenic
1027051533 7:75024427-75024449 TCTCCTGTTCTAGATGAGTGTGG + Exonic
1031694732 7:124836122-124836144 ACTTCTGGTATAGCAGAGTGAGG + Intronic
1032138634 7:129306628-129306650 CCTCCTGGTCTTGATGCTTGTGG + Intronic
1045589184 8:103574441-103574463 ACTCCTGCTCTAGTTTATTATGG + Intronic
1046054542 8:109063397-109063419 ACTCTTGGTCTTGATGCTTGGGG - Intergenic
1047267982 8:123326317-123326339 ACCCCTGTTCTAGATTATTGAGG - Intronic
1054929712 9:70623391-70623413 ACTGCTGCTCTAGCTGGTAGTGG - Intronic
1056896684 9:90557539-90557561 ACTGTTTGCCTAGCTGATTGTGG + Intergenic
1187868513 X:23745253-23745275 ACTCCTGGACTAGCCAACTGTGG + Intronic
1190217633 X:48490593-48490615 CCTCCTCGTCTAGCTGAAGGGGG + Intergenic
1192737457 X:73862729-73862751 ACTCCTTGTCTAGTGGAGTGAGG - Intergenic
1198273684 X:135080550-135080572 AGTCCTTGTCTATCTCATTGCGG - Intergenic