ID: 972470383

View in Genome Browser
Species Human (GRCh38)
Location 4:39398093-39398115
Sequence CTACCCAGAAGGAGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972470380_972470383 -7 Left 972470380 4:39398077-39398099 CCATTCTTTGGGGTACCTACCCA No data
Right 972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG No data
972470379_972470383 1 Left 972470379 4:39398069-39398091 CCTGGTTTCCATTCTTTGGGGTA No data
Right 972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG No data
972470378_972470383 2 Left 972470378 4:39398068-39398090 CCCTGGTTTCCATTCTTTGGGGT No data
Right 972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG No data
972470374_972470383 13 Left 972470374 4:39398057-39398079 CCTGGCAAAGTCCCTGGTTTCCA No data
Right 972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972470383 Original CRISPR CTACCCAGAAGGAGAACTGC TGG Intergenic
No off target data available for this crispr