ID: 972479295

View in Genome Browser
Species Human (GRCh38)
Location 4:39482774-39482796
Sequence CGACCAGATGAGGAAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972479290_972479295 18 Left 972479290 4:39482733-39482755 CCTGGACATGAGATGGGAGACTT No data
Right 972479295 4:39482774-39482796 CGACCAGATGAGGAAGGCTTGGG No data
972479289_972479295 22 Left 972479289 4:39482729-39482751 CCATCCTGGACATGAGATGGGAG No data
Right 972479295 4:39482774-39482796 CGACCAGATGAGGAAGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972479295 Original CRISPR CGACCAGATGAGGAAGGCTT GGG Intergenic
No off target data available for this crispr