ID: 972480185

View in Genome Browser
Species Human (GRCh38)
Location 4:39489304-39489326
Sequence GCTTCTGGAGTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972480185_972480190 23 Left 972480185 4:39489304-39489326 CCTGCTCTAGTCACTCCAGAAGC No data
Right 972480190 4:39489350-39489372 AGCTTGAAGAATCATCATCAGGG No data
972480185_972480189 22 Left 972480185 4:39489304-39489326 CCTGCTCTAGTCACTCCAGAAGC No data
Right 972480189 4:39489349-39489371 AAGCTTGAAGAATCATCATCAGG No data
972480185_972480187 -4 Left 972480185 4:39489304-39489326 CCTGCTCTAGTCACTCCAGAAGC No data
Right 972480187 4:39489323-39489345 AAGCTGACTAGTCTATGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972480185 Original CRISPR GCTTCTGGAGTGACTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr