ID: 972480660

View in Genome Browser
Species Human (GRCh38)
Location 4:39492957-39492979
Sequence CTCCTTCTGGATGTTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972480660_972480665 11 Left 972480660 4:39492957-39492979 CCAGCCACAACATCCAGAAGGAG No data
Right 972480665 4:39492991-39493013 ACTTTCCTTGTAGCTGTTTCAGG No data
972480660_972480667 24 Left 972480660 4:39492957-39492979 CCAGCCACAACATCCAGAAGGAG No data
Right 972480667 4:39493004-39493026 CTGTTTCAGGAATGTGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972480660 Original CRISPR CTCCTTCTGGATGTTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr