ID: 972480665

View in Genome Browser
Species Human (GRCh38)
Location 4:39492991-39493013
Sequence ACTTTCCTTGTAGCTGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972480661_972480665 7 Left 972480661 4:39492961-39492983 CCACAACATCCAGAAGGAGAAGA No data
Right 972480665 4:39492991-39493013 ACTTTCCTTGTAGCTGTTTCAGG No data
972480658_972480665 24 Left 972480658 4:39492944-39492966 CCAGGGATCATATCCAGCCACAA No data
Right 972480665 4:39492991-39493013 ACTTTCCTTGTAGCTGTTTCAGG No data
972480660_972480665 11 Left 972480660 4:39492957-39492979 CCAGCCACAACATCCAGAAGGAG No data
Right 972480665 4:39492991-39493013 ACTTTCCTTGTAGCTGTTTCAGG No data
972480664_972480665 -2 Left 972480664 4:39492970-39492992 CCAGAAGGAGAAGAGAGGGCAAC No data
Right 972480665 4:39492991-39493013 ACTTTCCTTGTAGCTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972480665 Original CRISPR ACTTTCCTTGTAGCTGTTTC AGG Intergenic
No off target data available for this crispr