ID: 972497395

View in Genome Browser
Species Human (GRCh38)
Location 4:39646770-39646792
Sequence TTCTCAAATTGACATATCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972497395_972497398 10 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497398 4:39646803-39646825 GAATAACTTTTGGCCAGGCTTGG No data
972497395_972497396 0 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497396 4:39646793-39646815 TCAAAAAGCAGAATAACTTTTGG No data
972497395_972497399 13 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497399 4:39646806-39646828 TAACTTTTGGCCAGGCTTGGTGG No data
972497395_972497397 5 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497397 4:39646798-39646820 AAGCAGAATAACTTTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972497395 Original CRISPR TTCTCAAATTGACATATCAT TGG (reversed) Intergenic