ID: 972497396 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:39646793-39646815 |
Sequence | TCAAAAAGCAGAATAACTTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972497395_972497396 | 0 | Left | 972497395 | 4:39646770-39646792 | CCAATGATATGTCAATTTGAGAA | No data | ||
Right | 972497396 | 4:39646793-39646815 | TCAAAAAGCAGAATAACTTTTGG | No data | ||||
972497394_972497396 | 24 | Left | 972497394 | 4:39646746-39646768 | CCAACTTGAAGCGTCTCACATTG | No data | ||
Right | 972497396 | 4:39646793-39646815 | TCAAAAAGCAGAATAACTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972497396 | Original CRISPR | TCAAAAAGCAGAATAACTTT TGG | Intergenic | ||