ID: 972497396

View in Genome Browser
Species Human (GRCh38)
Location 4:39646793-39646815
Sequence TCAAAAAGCAGAATAACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972497395_972497396 0 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497396 4:39646793-39646815 TCAAAAAGCAGAATAACTTTTGG No data
972497394_972497396 24 Left 972497394 4:39646746-39646768 CCAACTTGAAGCGTCTCACATTG No data
Right 972497396 4:39646793-39646815 TCAAAAAGCAGAATAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972497396 Original CRISPR TCAAAAAGCAGAATAACTTT TGG Intergenic