ID: 972497397

View in Genome Browser
Species Human (GRCh38)
Location 4:39646798-39646820
Sequence AAGCAGAATAACTTTTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972497394_972497397 29 Left 972497394 4:39646746-39646768 CCAACTTGAAGCGTCTCACATTG No data
Right 972497397 4:39646798-39646820 AAGCAGAATAACTTTTGGCCAGG No data
972497395_972497397 5 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497397 4:39646798-39646820 AAGCAGAATAACTTTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972497397 Original CRISPR AAGCAGAATAACTTTTGGCC AGG Intergenic