ID: 972497399

View in Genome Browser
Species Human (GRCh38)
Location 4:39646806-39646828
Sequence TAACTTTTGGCCAGGCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972497395_972497399 13 Left 972497395 4:39646770-39646792 CCAATGATATGTCAATTTGAGAA No data
Right 972497399 4:39646806-39646828 TAACTTTTGGCCAGGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972497399 Original CRISPR TAACTTTTGGCCAGGCTTGG TGG Intergenic