ID: 972497399 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:39646806-39646828 |
| Sequence | TAACTTTTGGCCAGGCTTGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972497395_972497399 | 13 | Left | 972497395 | 4:39646770-39646792 | CCAATGATATGTCAATTTGAGAA | No data | ||
| Right | 972497399 | 4:39646806-39646828 | TAACTTTTGGCCAGGCTTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972497399 | Original CRISPR | TAACTTTTGGCCAGGCTTGG TGG | Intergenic | ||