ID: 972498485

View in Genome Browser
Species Human (GRCh38)
Location 4:39656152-39656174
Sequence TTACTCTGCTTGCAAACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972498485_972498489 -3 Left 972498485 4:39656152-39656174 CCAGTTGTTTGCAAGCAGAGTAA No data
Right 972498489 4:39656172-39656194 TAAATAGACCATCAGGGACAGGG No data
972498485_972498486 -10 Left 972498485 4:39656152-39656174 CCAGTTGTTTGCAAGCAGAGTAA No data
Right 972498486 4:39656165-39656187 AGCAGAGTAAATAGACCATCAGG No data
972498485_972498487 -9 Left 972498485 4:39656152-39656174 CCAGTTGTTTGCAAGCAGAGTAA No data
Right 972498487 4:39656166-39656188 GCAGAGTAAATAGACCATCAGGG No data
972498485_972498488 -4 Left 972498485 4:39656152-39656174 CCAGTTGTTTGCAAGCAGAGTAA No data
Right 972498488 4:39656171-39656193 GTAAATAGACCATCAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972498485 Original CRISPR TTACTCTGCTTGCAAACAAC TGG (reversed) Intergenic
No off target data available for this crispr