ID: 972504629

View in Genome Browser
Species Human (GRCh38)
Location 4:39708812-39708834
Sequence CATAATAAGTAGTTGGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972504625_972504629 4 Left 972504625 4:39708785-39708807 CCCAGGCTTTTTGCATACCAGTT 0: 1
1: 0
2: 0
3: 17
4: 131
Right 972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG 0: 1
1: 0
2: 0
3: 21
4: 216
972504626_972504629 3 Left 972504626 4:39708786-39708808 CCAGGCTTTTTGCATACCAGTTT 0: 1
1: 0
2: 0
3: 18
4: 182
Right 972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG 0: 1
1: 0
2: 0
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972504629 Original CRISPR CATAATAAGTAGTTGGTTTT TGG Intronic
903749301 1:25610705-25610727 CATACTAAGGACTTGGCTTTGGG + Intergenic
904596436 1:31648995-31649017 CATAATAATTAGGTGGGTGTTGG - Intergenic
907506191 1:54920241-54920263 CATAATCAGAATTAGGTTTTAGG - Intergenic
908111634 1:60904001-60904023 CATCATCAAAAGTTGGTTTTAGG - Intronic
908739195 1:67309195-67309217 CCTACTATGTATTTGGTTTTTGG + Intronic
909568060 1:77077755-77077777 CAGAATAAGTTTTTGGATTTTGG + Intergenic
910560960 1:88590369-88590391 CAAAATAGAAAGTTGGTTTTTGG + Intergenic
911937349 1:103994794-103994816 CATAATAAGTAGTTGATGATAGG - Intergenic
912059669 1:105651264-105651286 CCTAGTGATTAGTTGGTTTTAGG + Intergenic
915197449 1:154200456-154200478 CACCATTAGTAGTTGCTTTTTGG + Exonic
915781781 1:158559893-158559915 GAAAATAAGTGGTTGTTTTTTGG - Intergenic
916574421 1:166054661-166054683 AATAATTAGTAGTTGCTTCTTGG + Intergenic
919433702 1:197530733-197530755 CATAATAAGTACTTGATAATCGG - Intronic
919435726 1:197557440-197557462 CATAATCAGTAAATAGTTTTGGG - Intronic
920719764 1:208376070-208376092 CATAATAATTAATTCATTTTGGG - Intergenic
920939407 1:210467206-210467228 CATACTAAGTAGTTAAATTTAGG + Intronic
922136931 1:222837982-222838004 GATAATAAGTAGTTGCCTCTGGG - Intergenic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1067009863 10:42700843-42700865 TATAATAAGTAGTTTGATTGTGG + Intergenic
1067802991 10:49372266-49372288 CATAATGATGACTTGGTTTTAGG - Intronic
1068507477 10:57920659-57920681 CATAATAAGCAGATGTTCTTTGG + Intergenic
1069172058 10:65244426-65244448 GATAATAAGTAACAGGTTTTGGG + Intergenic
1071081836 10:81822112-81822134 AATAATAAGTTGTTGCTTTAAGG - Intergenic
1071936998 10:90543081-90543103 CATATTAAGTACTTGATTTTAGG - Intergenic
1073715062 10:106095671-106095693 CAAAATAAGCATTTGGCTTTTGG + Intergenic
1073791557 10:106945223-106945245 CTTAAAAAGAAGTTGGTATTTGG + Intronic
1079197544 11:18343315-18343337 CGTAATAAGTAGTAGGTAATAGG + Intronic
1079654460 11:22971141-22971163 CATAACCAGGAGCTGGTTTTTGG - Intergenic
1081017754 11:37905190-37905212 ATTAATATGTGGTTGGTTTTTGG - Intergenic
1081061702 11:38486808-38486830 GAAAATAAGTAGTTGGGTTTAGG + Intergenic
1081105667 11:39065929-39065951 CATACTAAGTAATTATTTTTTGG + Intergenic
1082583963 11:54910935-54910957 CTTAATAAGAAATTGGTTTTAGG - Intergenic
1082994722 11:59244153-59244175 TATAATAAGGAGTTGGTTGTTGG - Intergenic
1085700940 11:78745835-78745857 CACAATGAGAAGTTGGCTTTGGG - Intronic
1085866533 11:80301401-80301423 CATAATAAATACTTGCTTATAGG - Intergenic
1085962475 11:81478352-81478374 CATTATAAGGTGATGGTTTTTGG - Intergenic
1086128839 11:83379639-83379661 TATAATAAATATTTGGTTTATGG - Intergenic
1086644805 11:89207174-89207196 TATAACAAGCAGCTGGTTTTTGG + Intronic
1086729604 11:90231557-90231579 CTTAATAAGGATGTGGTTTTAGG + Intergenic
1087192529 11:95270100-95270122 TATAATAAGTAATTGATTTCTGG + Intergenic
1087266101 11:96062996-96063018 CATACTAAAGAGTTTGTTTTGGG - Intronic
1088025691 11:105178967-105178989 CATAATAAATAATTATTTTTAGG + Intergenic
1089178942 11:116567661-116567683 GAAAATAAGCAATTGGTTTTTGG - Intergenic
1090319253 11:125827850-125827872 CATAAGAAGTGGTTGCTTATGGG + Intergenic
1091003098 11:131927340-131927362 TATAATTAGTAGTTGGTGCTGGG + Intronic
1092025635 12:5237383-5237405 CATAATCCGTAGTTAGATTTAGG - Intergenic
1093040616 12:14375308-14375330 AATAATAAATAGTTGCTTTTAGG + Intronic
1093973488 12:25396076-25396098 CATATAAAGTGGCTGGTTTTAGG + Intergenic
1094674795 12:32609298-32609320 CATAGGAAGTAGTTGGTTTGAGG - Intronic
1095678340 12:44946028-44946050 CATATTAAGTAGTTTTTTTCTGG - Intergenic
1098429918 12:70407974-70407996 CATAATAAGAAATTTGTATTTGG - Intronic
1098634721 12:72768061-72768083 AATAAGAAGTAGTAGGATTTGGG - Intergenic
1099149228 12:79088261-79088283 GATAACAAGAAGTTGGTTTAGGG + Intronic
1099396171 12:82143613-82143635 CAGAATAAATTGTTGGCTTTTGG - Intergenic
1100936239 12:99670314-99670336 CATAATAAATAGATGGTCCTAGG + Intronic
1102852072 12:116256973-116256995 TATTAAAAGTAGTTTGTTTTGGG - Intronic
1107587839 13:41871122-41871144 GATAAGAAGTAGTTGCATTTGGG - Intronic
1107588288 13:41876078-41876100 GATAAGAAGTAGTTGGATTTGGG - Intronic
1108897049 13:55343826-55343848 AATAATGAGAATTTGGTTTTAGG + Intergenic
1112644974 13:101319968-101319990 CATAAGAAGAATTTGGCTTTAGG - Intronic
1115932652 14:38514441-38514463 AAAAATAAGTAGTTGCTTATGGG - Intergenic
1116085012 14:40224441-40224463 CTTAATAGGTAGTTCTTTTTAGG - Intergenic
1117027286 14:51634447-51634469 CTTAACAAATAATTGGTTTTGGG - Intronic
1119955519 14:78794489-78794511 CATAAAAAGTAGTTGAAATTCGG + Intronic
1123634056 15:22285565-22285587 CAAAATAAAAAGTTGGTTTGGGG + Intergenic
1124555316 15:30719634-30719656 CATACTCAGAACTTGGTTTTGGG + Intronic
1126227060 15:46282927-46282949 CAAGATAAGTGGTTGGTTGTGGG + Intergenic
1130757639 15:86782887-86782909 CATAGAAAGTAGTTAGCTTTGGG - Intronic
1131112484 15:89774191-89774213 CAGGTTAAGGAGTTGGTTTTGGG - Intronic
1131207046 15:90458712-90458734 GATAAGAAGTAGTTGGCTCTAGG - Intronic
1131632777 15:94196670-94196692 CAGAAAAAGTAGTTATTTTTAGG + Intergenic
1138036644 16:53613893-53613915 CATTCTAAGTAGGTGGTCTTGGG - Intronic
1203115916 16_KI270728v1_random:1490382-1490404 CATAGGAAGTCTTTGGTTTTTGG - Intergenic
1147767976 17:42849569-42849591 AATCATAAGAAGGTGGTTTTGGG - Intronic
1148058474 17:44817245-44817267 CTTAATAAGTAGATGATTTTAGG - Intronic
1148058534 17:44817746-44817768 CTTAATAAGTAGATGATTTTAGG - Intronic
1148936529 17:51167623-51167645 CCTAAAAAGTAGGTGGTTTGAGG - Intronic
1153406902 18:4751011-4751033 CATAATATCAAGTTGGTTTCAGG - Intergenic
1155903850 18:31425541-31425563 CATAAAACTTACTTGGTTTTTGG + Intergenic
1156071307 18:33213969-33213991 AATAATAAGTAGCTTGTTGTGGG + Intronic
1156299598 18:35824613-35824635 CATAATAAGTAGATGGGAATGGG + Intergenic
1156407273 18:36794901-36794923 AATTATAAGTGGTTAGTTTTGGG + Intronic
1156880380 18:42070529-42070551 GATAAAAAGTAGTAGTTTTTAGG + Intronic
1159218298 18:65426320-65426342 CATAATAAGTAGTTTGGATAAGG - Intergenic
1163983948 19:20927584-20927606 CATAATAAGAAGGGTGTTTTTGG + Intronic
1164268410 19:23644216-23644238 CTTAATTTGTAGGTGGTTTTAGG + Intronic
1166685948 19:44796346-44796368 AAAAATAAGTAGATGGTTTGGGG - Intronic
1167804048 19:51767039-51767061 AAAAATAAGTAGTGGGTATTAGG - Intronic
925533434 2:4889850-4889872 CATAAAAAGGAGCTGGCTTTAGG + Intergenic
926771605 2:16382011-16382033 CATGAGAACTAGTTGGATTTTGG + Intergenic
929885286 2:45872602-45872624 GATAAGAAGTAGTTAGGTTTTGG + Intronic
931331934 2:61295932-61295954 TATAATAAGTAGTTTATTTGAGG - Intronic
934027652 2:88014668-88014690 CAAAATAATAAGTGGGTTTTAGG + Intergenic
936478320 2:112861236-112861258 CATAATTTGTAGTTTGATTTTGG - Intergenic
936841714 2:116777743-116777765 CAAAAAAAATAGTTTGTTTTAGG + Intergenic
938154639 2:128923920-128923942 CATTATAAGGAGTTGGATGTTGG + Intergenic
940476700 2:154170965-154170987 TATAAGCAGTAGTTGTTTTTGGG + Intronic
940617808 2:156072520-156072542 CATAATATTTAATTGGTTTTTGG + Intergenic
941389855 2:164898102-164898124 CAAAATAAGTAGGTGATTGTGGG - Intronic
941768010 2:169319291-169319313 AATAATAATTATTTGATTTTGGG - Intronic
941840982 2:170084219-170084241 CATAATTAGTAGTTGCTTTAGGG + Intergenic
942282528 2:174380404-174380426 CATAATAACTAAATGGTGTTTGG - Intronic
942882341 2:180876175-180876197 CAAATTAAAAAGTTGGTTTTTGG + Intergenic
943439628 2:187911624-187911646 AATAATAATTCTTTGGTTTTCGG + Intergenic
944904468 2:204249058-204249080 CATAATAAATTGCTAGTTTTAGG + Intergenic
945374206 2:209060262-209060284 CATAATAAATAGCTTGTTTCTGG + Intergenic
945601858 2:211877718-211877740 AATAATAAGTAGTTACATTTTGG - Intronic
946540586 2:220680248-220680270 CAGAATAAGAAGTTGTATTTAGG - Intergenic
946843007 2:223836806-223836828 CAAAATAAGGAGTTTGGTTTTGG - Intronic
947041210 2:225922775-225922797 TTTAATAAGTAGATGGTTTGTGG - Intergenic
948057810 2:235022251-235022273 CATAAGAAGTAGTTGCTACTTGG + Intronic
1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG + Intronic
1170657795 20:18305908-18305930 AATAAAATGTAGTTGCTTTTTGG - Intronic
1172922690 20:38499014-38499036 TATAATTAGCAGTTGGTATTAGG + Intronic
1174598557 20:51705091-51705113 CATAAGTAGTACTTGGGTTTAGG + Intronic
1175013924 20:55767995-55768017 AATAGTAAATAGTTTGTTTTTGG - Intergenic
1177331186 21:19665341-19665363 CATATTCTGTGGTTGGTTTTGGG - Intergenic
1177580854 21:23020819-23020841 CCTAATTAGGACTTGGTTTTAGG + Intergenic
1178833971 21:36080289-36080311 TATAAAGAGTACTTGGTTTTTGG - Intergenic
1184213818 22:43053096-43053118 CATCATAAGCAGCTGGGTTTGGG - Intronic
949442276 3:4094801-4094823 ATTAGTGAGTAGTTGGTTTTGGG - Intronic
949978655 3:9484316-9484338 CAAAATAACTAGCTGGTATTTGG - Intergenic
950817391 3:15720228-15720250 CATAAGGAATAGTTGCTTTTTGG - Intronic
952115981 3:30182130-30182152 TATCATAAGTAGTTGGTTTGGGG - Intergenic
953653698 3:44830524-44830546 CAAAATAAGTAGTTAACTTTAGG - Intronic
956213581 3:66826131-66826153 CAAAATAAGAAGTTGACTTTAGG - Intergenic
957516168 3:81254405-81254427 CTTATTAAGTTGTTGGTGTTTGG + Intergenic
957528784 3:81413569-81413591 TATAATAAATAGTTGATTTGGGG - Intergenic
957663171 3:83186918-83186940 AAAATTAAGTAGTTTGTTTTTGG + Intergenic
958761010 3:98308440-98308462 CATATGAAGTATTTGGTTTTTGG + Intergenic
962051055 3:131815937-131815959 TATACTCAGGAGTTGGTTTTGGG + Intronic
963195046 3:142517823-142517845 CTTAATAAGTTCTTTGTTTTTGG - Intronic
963891619 3:150641962-150641984 CAAAATGAAAAGTTGGTTTTTGG + Intergenic
965126488 3:164636953-164636975 CACAATAAGTTGTTTTTTTTTGG - Intergenic
966330373 3:178805466-178805488 CATAATAAGTGATTGGTTATAGG - Intronic
971359208 4:25921502-25921524 CACAAGAAGGAATTGGTTTTAGG + Intronic
972139066 4:35933567-35933589 AATAATAAGTTGTTCATTTTAGG - Intergenic
972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG + Intronic
972539976 4:40030840-40030862 CATAATAAATGTGTGGTTTTGGG - Intergenic
974367046 4:60963677-60963699 CATAAAAAATAGTAGGATTTAGG + Intergenic
974945641 4:68525142-68525164 AAAAATAAGTAGTGGGTTCTGGG + Intergenic
975174260 4:71269585-71269607 CCTAGCAAGTAGTTGGTGTTAGG + Intronic
975356428 4:73411016-73411038 CATATTACTTAGTTGGTTCTGGG + Intronic
978532162 4:109726451-109726473 AATGAGAAGTAGTTGGATTTTGG - Intronic
978644457 4:110913520-110913542 CAGAATAAGTCGTGAGTTTTAGG + Intergenic
979367421 4:119842151-119842173 AATAATCAGTAGGTGGTTGTTGG - Intergenic
979610768 4:122686742-122686764 CATAATAAGAAGTACGTATTTGG + Intergenic
980031480 4:127836812-127836834 TATAGTAAATAGTTGGTATTTGG + Exonic
980773952 4:137415305-137415327 CACACTGAGTACTTGGTTTTTGG - Intergenic
981241596 4:142483019-142483041 TATAATATGAAGTTAGTTTTTGG + Intronic
981341893 4:143631135-143631157 GATAACAAGAAGTTGGTATTTGG - Intronic
982972779 4:162011887-162011909 AATAATAAATAGCAGGTTTTAGG - Intronic
983953203 4:173666704-173666726 CATAAGAAGTACTTTGTTATGGG + Intergenic
984019532 4:174468185-174468207 CATTATAAGAACTTGGCTTTTGG + Intergenic
988034525 5:25808798-25808820 AATAACAAGTAGATGGTTGTTGG + Intergenic
988447165 5:31300625-31300647 CATATTAAAAAGTAGGTTTTGGG - Intronic
988729979 5:33962570-33962592 CATAATAAGCTGTTGGGTTTAGG - Intronic
992279206 5:75156247-75156269 GATAATAACTAGGTGGTCTTGGG + Intronic
992407469 5:76473389-76473411 TATTATAAGTAGTTTGTTCTGGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993177379 5:84504126-84504148 ACTAATAGGTAGCTGGTTTTTGG - Intergenic
995010336 5:107250265-107250287 CATAACAAGTAGTTGGTAACAGG + Intergenic
999753844 5:154649673-154649695 CCTGAAAAGGAGTTGGTTTTTGG - Intergenic
1000093759 5:157952879-157952901 CTTAAAAAGTGGTGGGTTTTGGG + Intergenic
1000451614 5:161395904-161395926 TATAATAAGTACTTGATCTTTGG + Intronic
1000882889 5:166717562-166717584 AATAAGAAGTAGTTGGGTTCAGG + Intergenic
1001195343 5:169668423-169668445 CATGTTAAGTTGTTTGTTTTTGG + Intronic
1007603683 6:43100768-43100790 TTTAAAAAGCAGTTGGTTTTTGG - Intronic
1008932118 6:56952618-56952640 CATAATAAGTATTCAGTATTTGG - Intronic
1009053341 6:58305346-58305368 AATAATAAGCAGTTGGATGTAGG - Intergenic
1009237774 6:61145216-61145238 AATAATAAGCAGTTGGATGTAGG + Intergenic
1009690520 6:67026426-67026448 CATTATCAGTAGTGAGTTTTAGG + Intergenic
1010260675 6:73812313-73812335 TATAATAATTATTTGGTTTGGGG + Intronic
1010851438 6:80782641-80782663 AGTAAGAAGTAGTTGTTTTTAGG - Intergenic
1011827309 6:91323584-91323606 CATAGAAAGTATTTGGTCTTTGG - Intergenic
1012170350 6:96009214-96009236 TAAAATAAGTGGTTGGTCTTAGG + Intergenic
1015900537 6:138060909-138060931 CATAATAAGCAGATGTTTGTAGG - Intergenic
1017347438 6:153400669-153400691 CAGAATAAGCGGTTGGTATTAGG + Intergenic
1017351280 6:153444998-153445020 CATAATTTGTAGTTTGATTTTGG + Intergenic
1018139279 6:160811769-160811791 CAGAATAAGCGGTTGGTATTAGG - Intergenic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1021539280 7:21738895-21738917 CATAATAATTATTAGATTTTGGG - Intronic
1021658483 7:22895204-22895226 CAAAATAAGGAGTTGGGGTTGGG - Intergenic
1022747687 7:33189434-33189456 CATAATAAATATGTGGTTTATGG + Intronic
1027178200 7:75918318-75918340 CAAAACAAGTTGTTGTTTTTTGG - Intronic
1027433799 7:78142261-78142283 CAAATTATGTAGTTGGTCTTAGG + Intronic
1027682164 7:81234300-81234322 CATAAAAAGTAGTTGCTTTCTGG + Intergenic
1027900291 7:84105139-84105161 AACAATAAGGAGTTGCTTTTGGG - Intronic
1028000020 7:85482505-85482527 CAATATAAGTTGTAGGTTTTAGG + Intergenic
1031436476 7:121738274-121738296 TTTAAAAAGTAGTTGGCTTTAGG - Intergenic
1031659643 7:124405872-124405894 CATAATAAGTGCTAGGTATTAGG + Intergenic
1033904417 7:146184115-146184137 CATACTGAGTAGTTGGTTCGGGG - Intronic
1034246985 7:149652654-149652676 CATAAAAATTAGTTGGGCTTTGG + Intergenic
1034610316 7:152361258-152361280 TTTATTAAGTAGTTGTTTTTAGG + Intronic
1037227775 8:16614957-16614979 CATATAAAGTAGTTTGATTTAGG - Intergenic
1037356598 8:18026558-18026580 AATAATAAAAAGTGGGTTTTTGG - Intronic
1041694586 8:60721950-60721972 CATACAAAGTAGTTGGGTTGGGG + Intronic
1042647316 8:71001517-71001539 CAAAATAAGTAGGTGATTTTTGG - Intergenic
1043648399 8:82554178-82554200 AATAATATGTATGTGGTTTTAGG - Intergenic
1044438592 8:92195705-92195727 AATTAAAAGTAGTTGCTTTTGGG - Intergenic
1047113349 8:121815266-121815288 AATAATAAATAGTTGTGTTTTGG + Intergenic
1052774979 9:32724136-32724158 CACAATAAATAGTTGCTTTATGG - Intergenic
1052951045 9:34211948-34211970 ACTGATAAGTTGTTGGTTTTGGG + Intronic
1055171182 9:73259999-73260021 CCTAGTGAGTAGTTGATTTTTGG + Intergenic
1058532547 9:105921176-105921198 CATAATAAGGGGTTGTTTTATGG - Intergenic
1058893004 9:109376999-109377021 CATAATAAACAATTTGTTTTTGG + Exonic
1059185604 9:112267440-112267462 CATTTTAAGAAGGTGGTTTTTGG - Intronic
1060707873 9:125822882-125822904 CATAATGAGTAGTTGAATTTTGG + Intronic
1060882126 9:127124549-127124571 TATAATAAGATGGTGGTTTTAGG + Intronic
1060886618 9:127159008-127159030 CAAAATAGGTAGTGGGTGTTAGG + Intronic
1185913099 X:4004308-4004330 CATAATATGCTGTTGATTTTGGG - Intergenic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186853237 X:13601148-13601170 CAAAATAAGCAGATTGTTTTAGG + Intronic
1188426756 X:30056991-30057013 CAAAACAAAAAGTTGGTTTTTGG - Intergenic
1188758264 X:33992020-33992042 AATATTTAGTAGTTGGCTTTGGG - Intergenic
1189318290 X:40071261-40071283 CATAAGCTGTGGTTGGTTTTGGG - Intronic
1189412127 X:40781752-40781774 CATAATATATACTTGATTTTTGG - Intergenic
1190542615 X:51494688-51494710 AATAATGAGTAGGAGGTTTTTGG + Intronic
1190805958 X:53836950-53836972 CAAAACAAAGAGTTGGTTTTTGG - Intergenic
1191115206 X:56845073-56845095 CATAATCTGTAGTTGGATTGAGG - Intergenic
1192619271 X:72661255-72661277 AATATTAAGTAATTGGCTTTAGG + Intronic
1193076460 X:77361069-77361091 TAAGGTAAGTAGTTGGTTTTTGG - Intergenic
1193637990 X:83976672-83976694 CATAATCAGTGGATGCTTTTAGG - Intergenic
1193845282 X:86462636-86462658 CATAATATATATTTGGTGTTTGG + Intronic
1195287858 X:103402869-103402891 GATAATAAATGGTTTGTTTTGGG + Intergenic
1195398682 X:104438509-104438531 GATAATAAGTAATTTGTTTGAGG - Intergenic
1195849982 X:109272396-109272418 CACAACAAGTAGTTGTTTTTTGG + Intergenic
1196394540 X:115245034-115245056 CTTAATAACTATGTGGTTTTGGG + Intergenic
1196841392 X:119862534-119862556 CATGAAAAGGAGTTGGATTTGGG - Intergenic
1197646159 X:129019400-129019422 CATAAAAAGGAGTTGGTTAATGG - Intergenic
1197685683 X:129437083-129437105 TGTAATAGGTAGGTGGTTTTAGG + Intergenic
1198402855 X:136284384-136284406 GATACTAAGTACATGGTTTTAGG + Intergenic
1200316903 X:155143677-155143699 CATAAAAAATAGTTGATTATGGG + Intronic
1200407362 Y:2826770-2826792 CAAAATAAGTAGTTTCTTTTTGG - Intergenic
1202305434 Y:23465233-23465255 CAAAATAAAAAGTTGGTTTGGGG + Intergenic
1202375557 Y:24232585-24232607 CATAATAAAAAGCTGGTGTTAGG + Intergenic
1202495223 Y:25437534-25437556 CATAATAAAAAGCTGGTGTTAGG - Intergenic
1202565375 Y:26205356-26205378 CAAAATAAAAAGTTGGTTTGGGG - Intergenic