ID: 972505988

View in Genome Browser
Species Human (GRCh38)
Location 4:39720619-39720641
Sequence AACCGGTAACTGATACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972505985_972505988 3 Left 972505985 4:39720593-39720615 CCTCAGGGAAAGAGTTTCTTGGG 0: 1
1: 0
2: 3
3: 20
4: 221
Right 972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 39
972505981_972505988 26 Left 972505981 4:39720570-39720592 CCTATGGAAGTTGGGTATTCTAG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972505988 Original CRISPR AACCGGTAACTGATACTTAC AGG Intronic
910391080 1:86745339-86745361 AAGGGGAAACTGATATTTACAGG - Intronic
911864394 1:102998290-102998312 ACCAGGTAGCTGTTACTTACAGG + Exonic
912048485 1:105491313-105491335 AACTTGTAAATGATTCTTACTGG - Intergenic
919132796 1:193472528-193472550 AACCTATAACTGATACAAACAGG + Intergenic
1068675943 10:59769890-59769912 AACCTGTAACTGATAATTGAGGG - Intergenic
1090295106 11:125580574-125580596 AGAGGTTAACTGATACTTACAGG + Intronic
1109624846 13:64961761-64961783 AACCCTGACCTGATACTTACTGG + Intergenic
1120538171 14:85722546-85722568 AGCCAGAAACAGATACTTACAGG + Intergenic
1122502356 14:102209254-102209276 AACCGATACGTGACACTTACGGG - Exonic
1131337497 15:91563306-91563328 ACCAGGAAACTGAAACTTACAGG - Intergenic
1138249949 16:55494220-55494242 ATTCTGTAACTGCTACTTACTGG + Intronic
1140513555 16:75526012-75526034 ACCGGGTAATTGATAATTACAGG + Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1166623074 19:44322489-44322511 AACCAGTGACTGATCCTAACAGG - Intergenic
1168310379 19:55456938-55456960 AACCGGGATCTGATAGTAACCGG - Intronic
926812506 2:16768350-16768372 AATGTGTAACTGATACTTCCAGG + Intergenic
931812414 2:65867649-65867671 AACCGGGAAGTGATAATTCCTGG - Intergenic
932848311 2:75157204-75157226 AACTGGTAACTGAGACTTGGAGG + Intronic
938234506 2:129694235-129694257 CACAGGTAACATATACTTACTGG + Intergenic
939150938 2:138472133-138472155 AGCCACTAACTGGTACTTACTGG + Intergenic
939603857 2:144228118-144228140 CACAGGTAACTGATACTATCAGG - Intronic
944897181 2:204177297-204177319 AACCTATAACTGAGACTTGCAGG - Intergenic
1170381364 20:15763137-15763159 ACCTGATAACTGATACTTAAAGG + Intronic
1172462850 20:35133189-35133211 AGCCGGTAACTGATACTGATGGG - Intronic
1179587821 21:42384863-42384885 ACCAGGTAACTGAAACTTACAGG - Intronic
967322114 3:188205003-188205025 AACCAGTACCTGCTACTTATTGG + Intronic
972505988 4:39720619-39720641 AACCGGTAACTGATACTTACAGG + Intronic
978250896 4:106630508-106630530 ACACAGTAAGTGATACTTACAGG - Intergenic
995194391 5:109347483-109347505 ATCCAGTAACTGGTAATTACAGG + Intronic
998201068 5:140121814-140121836 TACTGGGAACTGAGACTTACTGG + Exonic
1003742543 6:8959528-8959550 AACCTCTAAATGAAACTTACTGG + Intergenic
1004357909 6:14945991-14946013 AAGTGGTATCTGATCCTTACTGG - Intergenic
1011972905 6:93250511-93250533 AACAGCTACCTGATACTGACTGG - Intronic
1013146716 6:107401090-107401112 GGCCAGTAATTGATACTTACAGG - Intronic
1013584429 6:111565893-111565915 AATGGGTCACTAATACTTACAGG - Intronic
1022123885 7:27337239-27337261 ATCCGGTTAATGATACTGACAGG - Intergenic
1032108298 7:129053620-129053642 AACTCATAACTGATACTTAAAGG - Intronic
1034541017 7:151758197-151758219 ACCCAGTAACTGCTACTGACAGG - Intronic
1038089474 8:24237049-24237071 AACCTGTAATTGATAATTAAAGG + Intergenic
1038523656 8:28255299-28255321 AACTGGTAAATGATTCTTTCAGG - Intergenic
1195158992 X:102153321-102153343 AACATGTACCTGATAATTACAGG - Intergenic
1196184564 X:112732210-112732232 AAAAGGTATCAGATACTTACTGG - Intergenic
1199455677 X:148025428-148025450 AACAGGTAGCTGAGACTAACAGG - Intronic