ID: 972516605 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:39815464-39815486 |
Sequence | CAGTTTCGGGCTGGGCGCGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972516605_972516617 | 27 | Left | 972516605 | 4:39815464-39815486 | CCACCGCGCCCAGCCCGAAACTG | No data | ||
Right | 972516617 | 4:39815514-39815536 | CCTGATGCAGGCCCAGAGCCTGG | No data | ||||
972516605_972516615 | 15 | Left | 972516605 | 4:39815464-39815486 | CCACCGCGCCCAGCCCGAAACTG | No data | ||
Right | 972516615 | 4:39815502-39815524 | GGCTCAAGAAAGCCTGATGCAGG | No data | ||||
972516605_972516612 | -6 | Left | 972516605 | 4:39815464-39815486 | CCACCGCGCCCAGCCCGAAACTG | No data | ||
Right | 972516612 | 4:39815481-39815503 | AAACTGGAGACTTTATACCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972516605 | Original CRISPR | CAGTTTCGGGCTGGGCGCGG TGG (reversed) | Intergenic | ||