ID: 972516605

View in Genome Browser
Species Human (GRCh38)
Location 4:39815464-39815486
Sequence CAGTTTCGGGCTGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516605_972516617 27 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516605_972516615 15 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516605_972516612 -6 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516612 4:39815481-39815503 AAACTGGAGACTTTATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516605 Original CRISPR CAGTTTCGGGCTGGGCGCGG TGG (reversed) Intergenic