ID: 972516605

View in Genome Browser
Species Human (GRCh38)
Location 4:39815464-39815486
Sequence CAGTTTCGGGCTGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516605_972516615 15 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516605_972516612 -6 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516612 4:39815481-39815503 AAACTGGAGACTTTATACCCTGG No data
972516605_972516617 27 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516605 Original CRISPR CAGTTTCGGGCTGGGCGCGG TGG (reversed) Intergenic
No off target data available for this crispr