ID: 972516607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:39815467-39815489 |
Sequence | CTCCAGTTTCGGGCTGGGCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972516607_972516617 | 24 | Left | 972516607 | 4:39815467-39815489 | CCGCGCCCAGCCCGAAACTGGAG | No data | ||
Right | 972516617 | 4:39815514-39815536 | CCTGATGCAGGCCCAGAGCCTGG | 0: 1 1: 0 2: 2 3: 50 4: 492 |
||||
972516607_972516612 | -9 | Left | 972516607 | 4:39815467-39815489 | CCGCGCCCAGCCCGAAACTGGAG | No data | ||
Right | 972516612 | 4:39815481-39815503 | AAACTGGAGACTTTATACCCTGG | No data | ||||
972516607_972516615 | 12 | Left | 972516607 | 4:39815467-39815489 | CCGCGCCCAGCCCGAAACTGGAG | No data | ||
Right | 972516615 | 4:39815502-39815524 | GGCTCAAGAAAGCCTGATGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972516607 | Original CRISPR | CTCCAGTTTCGGGCTGGGCG CGG (reversed) | Intergenic | ||