ID: 972516607

View in Genome Browser
Species Human (GRCh38)
Location 4:39815467-39815489
Sequence CTCCAGTTTCGGGCTGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516607_972516612 -9 Left 972516607 4:39815467-39815489 CCGCGCCCAGCCCGAAACTGGAG No data
Right 972516612 4:39815481-39815503 AAACTGGAGACTTTATACCCTGG No data
972516607_972516617 24 Left 972516607 4:39815467-39815489 CCGCGCCCAGCCCGAAACTGGAG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516607_972516615 12 Left 972516607 4:39815467-39815489 CCGCGCCCAGCCCGAAACTGGAG No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516607 Original CRISPR CTCCAGTTTCGGGCTGGGCG CGG (reversed) Intergenic
No off target data available for this crispr