ID: 972516610

View in Genome Browser
Species Human (GRCh38)
Location 4:39815477-39815499
Sequence GGTATAAAGTCTCCAGTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516610_972516615 2 Left 972516610 4:39815477-39815499 CCCGAAACTGGAGACTTTATACC No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516610_972516617 14 Left 972516610 4:39815477-39815499 CCCGAAACTGGAGACTTTATACC No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516610 Original CRISPR GGTATAAAGTCTCCAGTTTC GGG (reversed) Intergenic
No off target data available for this crispr