ID: 972516615

View in Genome Browser
Species Human (GRCh38)
Location 4:39815502-39815524
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516609_972516615 6 Left 972516609 4:39815473-39815495 CCAGCCCGAAACTGGAGACTTTA No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516608_972516615 7 Left 972516608 4:39815472-39815494 CCCAGCCCGAAACTGGAGACTTT No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516610_972516615 2 Left 972516610 4:39815477-39815499 CCCGAAACTGGAGACTTTATACC No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516605_972516615 15 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516607_972516615 12 Left 972516607 4:39815467-39815489 CCGCGCCCAGCCCGAAACTGGAG No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data
972516611_972516615 1 Left 972516611 4:39815478-39815500 CCGAAACTGGAGACTTTATACCC No data
Right 972516615 4:39815502-39815524 GGCTCAAGAAAGCCTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type