ID: 972516617

View in Genome Browser
Species Human (GRCh38)
Location 4:39815514-39815536
Sequence CCTGATGCAGGCCCAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516610_972516617 14 Left 972516610 4:39815477-39815499 CCCGAAACTGGAGACTTTATACC No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516611_972516617 13 Left 972516611 4:39815478-39815500 CCGAAACTGGAGACTTTATACCC No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516614_972516617 -8 Left 972516614 4:39815499-39815521 CCTGGCTCAAGAAAGCCTGATGC No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516607_972516617 24 Left 972516607 4:39815467-39815489 CCGCGCCCAGCCCGAAACTGGAG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516613_972516617 -7 Left 972516613 4:39815498-39815520 CCCTGGCTCAAGAAAGCCTGATG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516608_972516617 19 Left 972516608 4:39815472-39815494 CCCAGCCCGAAACTGGAGACTTT No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516609_972516617 18 Left 972516609 4:39815473-39815495 CCAGCCCGAAACTGGAGACTTTA No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data
972516605_972516617 27 Left 972516605 4:39815464-39815486 CCACCGCGCCCAGCCCGAAACTG No data
Right 972516617 4:39815514-39815536 CCTGATGCAGGCCCAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516617 Original CRISPR CCTGATGCAGGCCCAGAGCC TGG Intergenic
No off target data available for this crispr