ID: 972516983

View in Genome Browser
Species Human (GRCh38)
Location 4:39818236-39818258
Sequence CTCTCTACACATACACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516983_972516985 -7 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG No data
972516983_972516991 30 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516991 4:39818289-39818311 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
972516983_972516987 -1 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516987 4:39818258-39818280 GAAGAAAATGAGGCCGGGCGCGG No data
972516983_972516990 29 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516990 4:39818288-39818310 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
972516983_972516986 -6 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516986 4:39818253-39818275 AGAGAGAAGAAAATGAGGCCGGG No data
972516983_972516988 2 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516988 4:39818261-39818283 GAAAATGAGGCCGGGCGCGGTGG 0: 7
1: 110
2: 1137
3: 5609
4: 19578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516983 Original CRISPR CTCTCTACACATACACAGCT TGG (reversed) Intergenic
No off target data available for this crispr