ID: 972516985

View in Genome Browser
Species Human (GRCh38)
Location 4:39818252-39818274
Sequence TAGAGAGAAGAAAATGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516983_972516985 -7 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG No data
972516981_972516985 13 Left 972516981 4:39818216-39818238 CCTTGTCATTAAGACAACCTCCA No data
Right 972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG No data
972516982_972516985 -4 Left 972516982 4:39818233-39818255 CCTCCAAGCTGTGTATGTGTAGA No data
Right 972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG No data
972516980_972516985 29 Left 972516980 4:39818200-39818222 CCATGCTGTGTGGATGCCTTGTC No data
Right 972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516985 Original CRISPR TAGAGAGAAGAAAATGAGGC CGG Intergenic
No off target data available for this crispr