ID: 972516987

View in Genome Browser
Species Human (GRCh38)
Location 4:39818258-39818280
Sequence GAAGAAAATGAGGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516982_972516987 2 Left 972516982 4:39818233-39818255 CCTCCAAGCTGTGTATGTGTAGA No data
Right 972516987 4:39818258-39818280 GAAGAAAATGAGGCCGGGCGCGG No data
972516983_972516987 -1 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516987 4:39818258-39818280 GAAGAAAATGAGGCCGGGCGCGG No data
972516981_972516987 19 Left 972516981 4:39818216-39818238 CCTTGTCATTAAGACAACCTCCA No data
Right 972516987 4:39818258-39818280 GAAGAAAATGAGGCCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516987 Original CRISPR GAAGAAAATGAGGCCGGGCG CGG Intergenic
No off target data available for this crispr