ID: 972516988

View in Genome Browser
Species Human (GRCh38)
Location 4:39818261-39818283
Sequence GAAAATGAGGCCGGGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26441
Summary {0: 7, 1: 110, 2: 1137, 3: 5609, 4: 19578}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516981_972516988 22 Left 972516981 4:39818216-39818238 CCTTGTCATTAAGACAACCTCCA No data
Right 972516988 4:39818261-39818283 GAAAATGAGGCCGGGCGCGGTGG 0: 7
1: 110
2: 1137
3: 5609
4: 19578
972516982_972516988 5 Left 972516982 4:39818233-39818255 CCTCCAAGCTGTGTATGTGTAGA No data
Right 972516988 4:39818261-39818283 GAAAATGAGGCCGGGCGCGGTGG 0: 7
1: 110
2: 1137
3: 5609
4: 19578
972516983_972516988 2 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516988 4:39818261-39818283 GAAAATGAGGCCGGGCGCGGTGG 0: 7
1: 110
2: 1137
3: 5609
4: 19578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516988 Original CRISPR GAAAATGAGGCCGGGCGCGG TGG Intergenic
Too many off-targets to display for this crispr