ID: 972516990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:39818288-39818310 |
| Sequence | TGCCTGTAATCCCAGCACTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 960678 | |||
| Summary | {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972516983_972516990 | 29 | Left | 972516983 | 4:39818236-39818258 | CCAAGCTGTGTATGTGTAGAGAG | No data | ||
| Right | 972516990 | 4:39818288-39818310 | TGCCTGTAATCCCAGCACTTTGG | 0: 89533 1: 228199 2: 240322 3: 214910 4: 187714 |
||||
| 972516989_972516990 | -6 | Left | 972516989 | 4:39818271-39818293 | CCGGGCGCGGTGGCTCATGCCTG | 0: 7065 1: 55609 2: 120140 3: 162711 4: 170813 |
||
| Right | 972516990 | 4:39818288-39818310 | TGCCTGTAATCCCAGCACTTTGG | 0: 89533 1: 228199 2: 240322 3: 214910 4: 187714 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972516990 | Original CRISPR | TGCCTGTAATCCCAGCACTT TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||