ID: 972516990

View in Genome Browser
Species Human (GRCh38)
Location 4:39818288-39818310
Sequence TGCCTGTAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 960678
Summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516983_972516990 29 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516990 4:39818288-39818310 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
972516989_972516990 -6 Left 972516989 4:39818271-39818293 CCGGGCGCGGTGGCTCATGCCTG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
Right 972516990 4:39818288-39818310 TGCCTGTAATCCCAGCACTTTGG 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516990 Original CRISPR TGCCTGTAATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr