ID: 972516991

View in Genome Browser
Species Human (GRCh38)
Location 4:39818289-39818311
Sequence GCCTGTAATCCCAGCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972516983_972516991 30 Left 972516983 4:39818236-39818258 CCAAGCTGTGTATGTGTAGAGAG No data
Right 972516991 4:39818289-39818311 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
972516989_972516991 -5 Left 972516989 4:39818271-39818293 CCGGGCGCGGTGGCTCATGCCTG 0: 7065
1: 55609
2: 120140
3: 162711
4: 170813
Right 972516991 4:39818289-39818311 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972516991 Original CRISPR GCCTGTAATCCCAGCACTTT GGG Intergenic
Too many off-targets to display for this crispr