ID: 972520583

View in Genome Browser
Species Human (GRCh38)
Location 4:39851634-39851656
Sequence AGAGATAAAAAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 0, 2: 8, 3: 50, 4: 648}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972520577_972520583 30 Left 972520577 4:39851581-39851603 CCTGGCTATCTAAATATTTTTTT 0: 1
1: 0
2: 24
3: 254
4: 1964
Right 972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG 0: 1
1: 0
2: 8
3: 50
4: 648
972520581_972520583 -8 Left 972520581 4:39851619-39851641 CCTGTTTAGGGTCACAGAGATAA 0: 1
1: 0
2: 3
3: 9
4: 162
Right 972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG 0: 1
1: 0
2: 8
3: 50
4: 648

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972520583 Original CRISPR AGAGATAAAAAGATGGAGCT AGG Intronic
900990854 1:6097601-6097623 AGAGATAAAGGGAGGGAGCTGGG + Intronic
901076344 1:6557212-6557234 AGAGATAAAGAGAATGGGCTGGG + Intronic
901466452 1:9424592-9424614 AGAGAAAAAAAAATGCAACTGGG + Intergenic
902677740 1:18020630-18020652 AGGGATAAAAAGAGGGAGAGGGG - Intergenic
903167058 1:21527891-21527913 AAGGAAAAAAAGATTGAGCTGGG - Intronic
903670317 1:25031435-25031457 AGAGATGGAAAGATGGAGGCTGG + Intergenic
903973495 1:27134295-27134317 ACAGATAAGATGATGGGGCTGGG + Intronic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
903994140 1:27294801-27294823 TGAAATAAAAAGACTGAGCTAGG - Intronic
904392870 1:30197260-30197282 AGAGTTAAGGAGATGGAGATCGG - Intergenic
904495298 1:30883183-30883205 AGAGACAAAAAGAGAGAGGTTGG + Intronic
904617580 1:31758216-31758238 AGAGGAGAAAAGATGGGGCTAGG + Intronic
904998543 1:34650343-34650365 AGAGAGAAAAAGAAGGAGGGAGG + Intergenic
905400444 1:37698668-37698690 AGAGATAAGAAAATGGAACAAGG + Intronic
905589566 1:39150990-39151012 AGAGATAAAATCTTGGAGCTCGG - Intronic
905733463 1:40311554-40311576 GGAGACATGAAGATGGAGCTTGG + Intronic
907177466 1:52538365-52538387 TGAGAAAAAAAAAGGGAGCTGGG + Intronic
907455644 1:54573734-54573756 AGAAATAAAAAAATGTGGCTGGG + Intronic
907724556 1:57007013-57007035 AGAGAGAAAAAAAAGGAGGTAGG - Intronic
907956900 1:59237605-59237627 AGGGAGAAAAAGATAGAGCAGGG - Intergenic
908431593 1:64063940-64063962 AGAGAGAGAAAGGTAGAGCTGGG - Intronic
908883022 1:68754653-68754675 AAAGATTAAAAGATGGGGCCGGG + Intergenic
909022087 1:70443192-70443214 AGAGAAAAAAAAATAAAGCTTGG + Intergenic
909138627 1:71834412-71834434 AGAGATATAAAGGTGGAGGAAGG + Intronic
909813648 1:79962727-79962749 AGTAATAAAAAGATGGAGGTAGG + Intergenic
910730807 1:90393790-90393812 AGAGAAAAGAAGATAGACCTAGG - Intergenic
910744445 1:90558234-90558256 AAAGATAAGGAGTTGGAGCTTGG - Intergenic
910991699 1:93063366-93063388 ATATAGAAAAAGAGGGAGCTTGG - Intergenic
911643453 1:100313644-100313666 AGAGATGAATAGGTGGAGCACGG - Intergenic
912013349 1:105000255-105000277 AGAGATAAAAACAGGAAACTAGG - Intergenic
912153409 1:106885696-106885718 AGAAAAAAAAAGATGGAGAAGGG + Intergenic
912156269 1:106924477-106924499 AGAGGTAGAAAGCTGGAGCTGGG - Intergenic
912333459 1:108841213-108841235 AGAAATAAAATGATGGAGCAAGG + Intronic
912838149 1:113014987-113015009 AGAGAAAAAAAGAATTAGCTGGG - Intergenic
913556381 1:119971416-119971438 AGAGATACAGTGATGTAGCTTGG - Intronic
913556467 1:119972086-119972108 AGAGAGTAAAAGATGGAGGGAGG + Intronic
914001505 1:143698627-143698649 AGAGATAGAAAGAGGCGGCTTGG + Intergenic
915203821 1:154254042-154254064 GGTGATGAAGAGATGGAGCTGGG - Exonic
915498318 1:156296634-156296656 AGAGAGAGAAAGAAGGGGCTAGG + Intergenic
915826794 1:159086538-159086560 TGAGATATAAAGAAGGACCTGGG - Intronic
915927793 1:160037326-160037348 AGAGAAAAACAGAAGGGGCTTGG + Intergenic
916232751 1:162556528-162556550 AGAGATAGATAGATAGAGCCGGG - Intergenic
916504290 1:165413938-165413960 ACAGATAAAGAGATGGAATTGGG - Intronic
916611224 1:166393839-166393861 AGAAATAAAAAGATGGATAGTGG - Intergenic
916953948 1:169811877-169811899 ATAGATAGATAGATAGAGCTTGG + Intronic
917105955 1:171492394-171492416 AGAAAGAAAAAGAAGGAGTTGGG + Intronic
917416013 1:174810034-174810056 AGTAATCAAAAAATGGAGCTAGG - Intronic
917611737 1:176695711-176695733 GGAGATAAAGGGATGGAGATGGG - Intronic
917899635 1:179529582-179529604 AGAGAGAAAAGGAAGAAGCTTGG + Intronic
918352836 1:183675396-183675418 AGAGAAAAAAAAATGTAGGTTGG - Intronic
918370552 1:183857159-183857181 AGAGATACAAGGATGGAAATGGG + Intronic
918609208 1:186467132-186467154 AGAAATAAAGAGATAGAGATAGG + Intergenic
920634355 1:207685152-207685174 AGAGATAAAAATATAGATATAGG - Intronic
920830792 1:209463937-209463959 AGAGATAGAGAGATAGAGATTGG - Intergenic
920923833 1:210322656-210322678 AGAGATAAAAACAATTAGCTGGG + Intergenic
921313404 1:213868226-213868248 AGGGATTCAAAGAGGGAGCTAGG - Intergenic
922638438 1:227201304-227201326 AGAGATAAAAAAAATTAGCTGGG - Intronic
923057344 1:230436964-230436986 TGAAATATAAAGATTGAGCTGGG + Intergenic
923201280 1:231714563-231714585 AGAGACAGAGAGATGGAGATGGG + Intronic
923664753 1:235990229-235990251 AGAGAAGAAAAGCTGGAGGTTGG + Intronic
923802194 1:237220933-237220955 AGTAATAAAAAAATGTAGCTGGG + Intronic
923846257 1:237736163-237736185 AAAGATAAAAGGATAGGGCTGGG + Intronic
1062918203 10:1258107-1258129 AAAGAGAAAAAGAGAGAGCTAGG - Intronic
1063186979 10:3660507-3660529 AGAAAGAAAAAGATGGAGACTGG + Intergenic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1063847534 10:10147867-10147889 AGAGATAAAAGGAGGGAGTGAGG - Intergenic
1064277538 10:13920300-13920322 GGAGACAAAAACATGGAGTTGGG - Intronic
1064295045 10:14071597-14071619 GGAGATAAAGAGGTGGAGATGGG + Intronic
1065286040 10:24188639-24188661 AGGGAAAGAAAGATGGAGGTTGG + Intronic
1065856382 10:29833584-29833606 AAGGAAAAAAAGATGGATCTTGG + Intergenic
1065873326 10:29974998-29975020 AGACAAAAAAAAAAGGAGCTTGG + Intergenic
1067325472 10:45261888-45261910 AGAGACAAAACCCTGGAGCTAGG + Intergenic
1067712532 10:48661489-48661511 AGAGAAAAAAGGATGGACTTGGG - Intergenic
1067964438 10:50893666-50893688 AGAGGTGAAATGATAGAGCTGGG + Intergenic
1068059953 10:52054721-52054743 AGGGAAAAAAAGATGTAACTTGG + Intronic
1068099441 10:52533085-52533107 AGAGAAAGAAAGAGGGAGGTGGG - Intergenic
1069753404 10:70759344-70759366 AGAGAGAGAAAGAGGGAGGTGGG - Intronic
1070165023 10:73890847-73890869 AGAGAAAGAAAGTGGGAGCTGGG + Intergenic
1070843358 10:79503298-79503320 AGAGAGAGAGAGATGGAGATGGG - Intergenic
1070930301 10:80256302-80256324 AGAGAGAGAGAGATGGAGATGGG + Intergenic
1072010756 10:91301102-91301124 AGAGCCTAAAAGTTGGAGCTTGG + Intergenic
1072444744 10:95489237-95489259 AGAGAGAAAAAGAAGGAGATTGG - Intronic
1072625647 10:97109607-97109629 AGGGATGAAACGATGGAGTTTGG + Intronic
1072635189 10:97173482-97173504 AAAAAAAAAAGGATGGAGCTGGG - Intronic
1072893119 10:99342941-99342963 AGAAAAAAAAAGATGGGACTAGG - Intronic
1073973524 10:109073243-109073265 AGAGAGACAAAGATGGGGGTGGG + Intergenic
1074006135 10:109426187-109426209 AGAGAGGAGAAGAAGGAGCTTGG + Intergenic
1074213537 10:111361326-111361348 AAAGATAAAAAGAAAGAGTTTGG - Intergenic
1075763106 10:124871483-124871505 AGCGATAAAGAAATGGGGCTGGG + Intergenic
1077083784 11:737267-737289 GGGGAAAAAAAGATGGAGCCGGG - Intergenic
1077345026 11:2043530-2043552 AGAGAAAAAAACATGGAGAATGG - Intergenic
1077736092 11:4792803-4792825 AGAGAAAAGAAGAAGGAGCGGGG + Intronic
1077766606 11:5165084-5165106 AGAGATAAGAGGATGGGGCGTGG + Intronic
1078681254 11:13478793-13478815 AGAAATAAAAAGATGGATTGCGG + Intergenic
1079802154 11:24882961-24882983 AGAGAAAGAAAGATGGAGGAAGG + Intronic
1079829160 11:25239720-25239742 AGAGACAAAAGCATGGAGGTGGG + Intergenic
1080645688 11:34186117-34186139 AGAGAGCAAAAGCTGGAGGTTGG - Intronic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1081013607 11:37847521-37847543 AGAGAATAAAGGTTGGAGCTGGG - Intergenic
1081015613 11:37875938-37875960 AAAGTTAAAAACATGGAGCTGGG - Intergenic
1081790038 11:45776080-45776102 GGAGAAAAAAAGGTGGATCTGGG - Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1081885681 11:46493930-46493952 AGAGATGAAAAAGTGGTGCTGGG - Intronic
1082651800 11:55803311-55803333 AGAGAAATAGAGATGGAGATAGG + Intergenic
1084591494 11:70093224-70093246 AGAGTGAAAAAGAGGGAGGTGGG - Intronic
1084803110 11:71559115-71559137 AGAGAGAAAGAGATGGAGGGAGG - Intronic
1085180412 11:74530796-74530818 AAAGATTAAAAAATGGAGCCAGG - Intronic
1086405742 11:86497755-86497777 AGAGGGAACAGGATGGAGCTAGG + Intronic
1086897727 11:92333086-92333108 ATACATAAAAATATGGTGCTTGG - Intergenic
1086920046 11:92575862-92575884 AGGAATAGAAAGGTGGAGCTTGG + Intronic
1087224570 11:95583572-95583594 AGAGATTGAATGATGGAGCAAGG + Intergenic
1087436912 11:98131699-98131721 AGAGCTCAAAAGACAGAGCTAGG - Intergenic
1087794071 11:102437274-102437296 AGGGTTAAAGAGATGGGGCTGGG - Intronic
1088127533 11:106446978-106447000 AGAGATAAAATGATGGTGGAGGG + Intergenic
1088713619 11:112529574-112529596 AGAGATAAAAACCAGGAGTTAGG - Intergenic
1088721611 11:112597002-112597024 AGAGAGAAAAAGATGGAGACGGG - Intergenic
1088826989 11:113504225-113504247 GGAAAAAAAAAAATGGAGCTGGG + Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1088993582 11:114976429-114976451 AGAGAAAAGAGGCTGGAGCTGGG + Intergenic
1089958376 11:122593786-122593808 AGTGATAATAAGAGGGAACTGGG + Intergenic
1090155127 11:124429100-124429122 GGAGATAAAAAGATAAAGCCTGG + Intergenic
1091086779 11:132728412-132728434 AGACAAAAGATGATGGAGCTAGG + Intronic
1091287833 11:134418164-134418186 TGAGAAAACATGATGGAGCTAGG + Intergenic
1091362463 11:134988498-134988520 AGAGATGAAATGATGGGTCTGGG + Intergenic
1202827955 11_KI270721v1_random:98402-98424 AGAGATAAAAACATGGAGAATGG - Intergenic
1092139072 12:6170439-6170461 AGAAATAGAAAAATAGAGCTGGG + Intergenic
1092172281 12:6381462-6381484 AGAGATAAAGTGATGGGGCCAGG + Intronic
1093191374 12:16078711-16078733 AGAGATAGGAAGTTGGTGCTGGG + Intergenic
1093925585 12:24905122-24905144 AGACAGAAGAGGATGGAGCTTGG + Intronic
1093971489 12:25380115-25380137 AGTGGTGAAAAGATGGAGATAGG - Intergenic
1095204857 12:39427953-39427975 AGAAAGAAAAAGATGTGGCTGGG - Intronic
1095257677 12:40059188-40059210 AGGGATAAGACAATGGAGCTAGG - Intronic
1096842834 12:54389969-54389991 AGAGAAAAAGAGATGGAGGAAGG + Intronic
1097387755 12:58969923-58969945 CAAGTTAAAAAGATGAAGCTGGG + Intergenic
1098838242 12:75446802-75446824 GGAAAAAAAAACATGGAGCTTGG + Intergenic
1099396074 12:82141488-82141510 AGAGACAGAAAGATAGAGCGAGG + Intergenic
1099775513 12:87122922-87122944 AGAGAGAAAAAGAGGAAGCATGG + Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1101000744 12:100355282-100355304 AGAGAGAAAAGGTTGGAGCCAGG + Intergenic
1101377921 12:104187019-104187041 AAAAATAAAAAAATGTAGCTGGG - Intergenic
1101436880 12:104671725-104671747 AGAGAGAGAAAGATAGAGATTGG - Intronic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1102121719 12:110447113-110447135 AGAGCTGAAAAGATAGTGCTTGG - Intronic
1102138820 12:110597705-110597727 AGAGAAAAAAAGGAGGAGCCAGG + Intergenic
1102172211 12:110850923-110850945 AGAGAAGAAAAGTTGGAGGTTGG - Intronic
1102449609 12:113031044-113031066 AGAGAGAAAAGGAGGGAGATGGG - Intergenic
1102641366 12:114369952-114369974 AGAGATAAGAAAATGCAGATGGG + Intronic
1102944599 12:116974904-116974926 ATAAATAAAAAGATGAAGGTAGG + Intronic
1103206512 12:119133662-119133684 AGAGAGAAAAACTTGGGGCTAGG - Intronic
1103528509 12:121583212-121583234 AGAGAAAAGAAGATGCAGCGTGG + Intergenic
1104142286 12:126000154-126000176 AGAGAGTAAAAGATGGAAATAGG + Intergenic
1105891078 13:24682705-24682727 AGTGGTAAAAATGTGGAGCTTGG + Intronic
1106121062 13:26860413-26860435 AGAAGTAAAAGGATGAAGCTGGG + Intergenic
1107043517 13:35973066-35973088 AGAGAAAGAAAGATGGAGAAAGG + Intronic
1107751210 13:43569367-43569389 AGAGATAGATAGATAGAACTAGG + Intronic
1107922984 13:45229203-45229225 AGAGAGAAAAAGAGGGAGCGAGG - Intronic
1108202492 13:48057429-48057451 AGAGATAAGAGGTTGGGGCTTGG - Intronic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109239201 13:59862883-59862905 AGGGATAAAAAGTTGGTTCTTGG - Intronic
1110545201 13:76748331-76748353 GGAGATAGAAAGGTGGAGGTTGG - Intergenic
1110761476 13:79235405-79235427 TGAGCTAAGGAGATGGAGCTGGG + Intergenic
1110905336 13:80880391-80880413 ACAGATAGAAAGCTGGAGCAAGG + Intergenic
1110935372 13:81281063-81281085 AGGGATAAAAAGTTGGAGTAAGG + Intergenic
1111095152 13:83503957-83503979 AGAGAAAAGGAGATGGAGTTTGG - Intergenic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1112191145 13:97178960-97178982 TGAGATAAATAGTTGAAGCTGGG + Intergenic
1112323366 13:98427219-98427241 AAAGATAAAACTATGGAGATGGG - Intronic
1112814622 13:103257393-103257415 AGAGATAAAAAGGTTGATCATGG - Intergenic
1112911077 13:104484404-104484426 AGGGATAAAATAATTGAGCTGGG + Intergenic
1113868690 13:113545280-113545302 AGAGATTGAAACATCGAGCTGGG + Intronic
1114072884 14:19129174-19129196 ACAGATAAAGAGATGTAACTGGG - Intergenic
1114089376 14:19270800-19270822 ACAGATAAAGAGATGTAACTGGG + Intergenic
1114143113 14:19939922-19939944 AGAAACAAAAATATGAAGCTTGG + Intergenic
1114902689 14:27084559-27084581 TGAGATGGAAAGATGGAGTTTGG + Intergenic
1115821431 14:37216294-37216316 AGAGATAAAGAGAGAGAGATAGG + Intronic
1116693537 14:48142435-48142457 AGAGAAAAAAAAATGTAGCAGGG + Intergenic
1117563081 14:56964935-56964957 AGAGTTGAAAAAATGGAGTTGGG - Intergenic
1117600989 14:57374342-57374364 AGAGGTAAAAAGATTGAGTGTGG + Intergenic
1117757474 14:58990674-58990696 ACTGATAATAAGATGGAGTTTGG + Intergenic
1118772257 14:68949998-68950020 AGAGTTCAGAAGATGGGGCTGGG + Intronic
1118850500 14:69579417-69579439 GGAGGCAAAAAGATGGGGCTGGG + Intergenic
1118937487 14:70300794-70300816 AGAGATAAGAGGATGGGGCGTGG + Intergenic
1119061276 14:71477333-71477355 AGAGAGAAAACTATGGAGATGGG - Intronic
1119075617 14:71634975-71634997 AGTGATAAAAGAATGGATCTTGG + Intronic
1119568681 14:75650583-75650605 AGAGACAAAAAAATAGAACTAGG - Exonic
1120017348 14:79488918-79488940 GGAGGAAAAAAGATAGAGCTAGG - Intronic
1120197474 14:81500754-81500776 AGATATAAAAAGGAGGAGCAAGG + Intronic
1120255346 14:82111881-82111903 ATAGATACAAAAATGGATCTAGG - Intergenic
1121035360 14:90698944-90698966 AGAGAAGAAAAGATGGAAGTAGG - Intronic
1121138719 14:91522073-91522095 AGAGAACAAAAGAGGGATCTTGG - Intergenic
1121903177 14:97713163-97713185 AGAGAGTAAATGGTGGAGCTAGG - Intergenic
1121959502 14:98246103-98246125 AGAGATTAAGAGATGAAGTTTGG + Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122162987 14:99800150-99800172 AGTGAGAAAAACATGAAGCTGGG - Intronic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1123970945 15:25507422-25507444 ACAGCTAAAAAGATGGAGCCAGG - Intergenic
1124185744 15:27527069-27527091 AGAAATAAAAGGATTTAGCTGGG + Intronic
1124463283 15:29912713-29912735 AAAAAAAAAAAGAGGGAGCTTGG + Intronic
1124780192 15:32623293-32623315 AGAAGTAAAAAGATGGGCCTTGG + Intronic
1124790637 15:32722783-32722805 AGAGAAAAAAAGGTGGAGATGGG + Intronic
1125211619 15:37222751-37222773 AGAGAAAAATAAATGGAACTGGG + Intergenic
1125426225 15:39552379-39552401 AGAGGTAAACAGATGCACCTGGG - Intergenic
1125810687 15:42538550-42538572 AAGGATAAAAAAATGGAGCCAGG - Exonic
1126434229 15:48619429-48619451 AGAGAGAAACAGATGGACCATGG - Intronic
1126843250 15:52737413-52737435 AGAGATGAAAAGATGAAAATAGG - Intergenic
1126848290 15:52782340-52782362 TGAGATAATAAGATTGGGCTAGG - Intronic
1128043493 15:64596146-64596168 AAAGAAAAAAAGAAAGAGCTTGG - Intronic
1128076588 15:64830406-64830428 AGAGAGAAAATGAAAGAGCTGGG + Intergenic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128849691 15:70941113-70941135 AGAATTCAAAAGCTGGAGCTAGG - Intronic
1130672231 15:85922860-85922882 AGAAAGAAAGTGATGGAGCTGGG + Intergenic
1130834682 15:87638321-87638343 AGAGAGAAGAAGATGGAGCTGGG - Intergenic
1131055593 15:89372599-89372621 AGAGATGAAAAGCTGGCTCTAGG - Intergenic
1132100959 15:99022964-99022986 AGAGAGAAAAAAATGGGACTGGG - Intergenic
1133088805 16:3387357-3387379 AGATATAAACAGATAGAGATGGG - Intronic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133377144 16:5296652-5296674 AGAGAAAAAAAAATGGTGGTTGG - Intergenic
1133404488 16:5512141-5512163 GGAGATAAAATGATGGATGTGGG + Intergenic
1133848860 16:9482923-9482945 AGAGATGAAAAGCTAGAGATAGG + Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135274373 16:21098902-21098924 AGAGAGAGAAAGATGGAGTTGGG - Intronic
1135842379 16:25888353-25888375 AGAGATAAAGAGAGGGAGAAAGG - Intronic
1136687466 16:32003645-32003667 AGAGATAAAAAGAAGCTTCTGGG - Intergenic
1137010516 16:35315961-35315983 AGAGATAACTAGAAGGTGCTTGG + Intergenic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1138646353 16:58428126-58428148 AGCCATAAAAAGATGGAGGTAGG - Intergenic
1139816013 16:69673003-69673025 AGAGAAAGAAAAATGGAGGTAGG - Intronic
1140060984 16:71569495-71569517 AGAAATAAAAAAAATGAGCTGGG - Intronic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141458781 16:84163672-84163694 AGAAATAAAAAGACAGGGCTGGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1143181218 17:4985722-4985744 AGGTATAAAAACATGGATCTTGG - Intronic
1143858391 17:9869738-9869760 AGAGAGAGAAAGAGAGAGCTGGG + Intronic
1143992910 17:10981782-10981804 GGAGAAAAGAAGATGGGGCTGGG + Intergenic
1144237770 17:13278664-13278686 AGAGGTAAAATGATGGAGGCAGG + Intergenic
1146796870 17:35787856-35787878 AGAGAGAGAAAGAAGGAGCAGGG - Intronic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148235318 17:45964798-45964820 AGAAAGAAAAAGATGGAGTGGGG - Intronic
1149033730 17:52111644-52111666 AGGGATAGAAAGAGAGAGCTGGG + Intronic
1149374070 17:56026160-56026182 AGAGATAAATAGGTAGAGCATGG + Intergenic
1149397082 17:56255876-56255898 AGAGATAGAAATTTGGGGCTGGG + Intronic
1150099678 17:62411787-62411809 AGAGAGAAAGAGATGGAGGGAGG + Intronic
1150736649 17:67745842-67745864 AAAGATAAAAAGGTGGGGCCGGG - Intergenic
1150743151 17:67795807-67795829 AGCGATAAAAGGAAGGAGCTTGG + Intergenic
1150773064 17:68057987-68058009 ATAGATAGATAGATGGATCTTGG + Intergenic
1151879243 17:76885265-76885287 TGAGGGAGAAAGATGGAGCTGGG - Intronic
1153192355 18:2555992-2556014 TGAGTTAAGGAGATGGAGCTTGG + Intronic
1153206199 18:2704843-2704865 AGAGGTAAAAGGATTGAGCCTGG + Intronic
1153793593 18:8602304-8602326 AGACATCAAAAAATGGAGTTAGG + Intergenic
1154293159 18:13127972-13127994 ACAGTTAAAAAGTTTGAGCTGGG + Intergenic
1154489372 18:14907848-14907870 AGAGATGAAATGATGGCTCTGGG - Intergenic
1155829177 18:30491684-30491706 AGAGATTGAAGGATGGTGCTTGG - Intergenic
1156859952 18:41824315-41824337 AGGGATAACAAGAGGAAGCTAGG + Intergenic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1157203794 18:45681550-45681572 AGAGAAAAAGAGCTGGAGATTGG + Intronic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1158158375 18:54451392-54451414 AGAGATGAAAAGATAGAGGATGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158755164 18:60315480-60315502 AGAGATCTGAAGATGGACCTGGG + Intergenic
1159320141 18:66837897-66837919 ATAGATGAAAGGCTGGAGCTTGG + Intergenic
1159724416 18:71936610-71936632 ATAGATAAATAGATAGATCTAGG - Intergenic
1160502728 18:79410378-79410400 AGAGAGAAAAAGAAGCAGATGGG - Intronic
1162204686 19:9046942-9046964 AGAGAGAAAAAGAGGGAGGGAGG - Intergenic
1163046859 19:14649467-14649489 AGAGATCAAAAGAGAGAGATGGG - Intronic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1164134124 19:22396603-22396625 AGAAAAAAAAAGTTGGATCTTGG - Intronic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1164983271 19:32630061-32630083 AAAAATAACAAGATGAAGCTGGG - Intronic
1165438676 19:35811555-35811577 AAAGAAAAAAAGATGGAGTAGGG + Intronic
1166273395 19:41733320-41733342 AGAGACAAAAATAATGAGCTGGG + Intronic
1166473403 19:43099726-43099748 GGAGATAAAATGATGCAGGTAGG - Intronic
1166780135 19:45337830-45337852 AGAAAGAAATAGCTGGAGCTTGG + Intronic
1166875609 19:45895471-45895493 GGAGAAAAAAAGAAGGAGATGGG - Intronic
1167686322 19:50958983-50959005 AGTGATGCAAGGATGGAGCTGGG + Exonic
1167794491 19:51700797-51700819 AGAGACAAAAACAGGGAACTTGG + Intergenic
1168070312 19:53946537-53946559 AGAGATAAATAGATGGAACCAGG - Intergenic
1168299014 19:55392828-55392850 AGACATTAAAAGATGAGGCTGGG - Intronic
925585700 2:5461933-5461955 AGAGCTATAAAGAGGGATCTTGG + Intergenic
925898133 2:8488778-8488800 AAAGAGAGCAAGATGGAGCTGGG + Intergenic
926517646 2:13868922-13868944 AGAGAGAAAGAGATCGACCTAGG - Intergenic
926953027 2:18264603-18264625 AGAGTCAGAAAAATGGAGCTGGG + Intronic
926975344 2:18511043-18511065 AGAGATAAAAAGCTGAAGCTTGG - Intergenic
927014001 2:18936901-18936923 AGAGACAGAAAGAGAGAGCTAGG - Intergenic
927072603 2:19546346-19546368 AGTGAGAAAAACATGGAGCTTGG - Intergenic
927290674 2:21402039-21402061 AGAGAGAAAGCAATGGAGCTTGG + Intergenic
927441227 2:23119458-23119480 AGAGAGAAGAAGATGAAGCAAGG - Intergenic
927517370 2:23680222-23680244 GGAGGTAAAAAGATGGGACTTGG + Intronic
927970055 2:27299966-27299988 AAAAATAAATAAATGGAGCTGGG - Intronic
928367941 2:30717112-30717134 AAAGACAAAAAGATGGAAATGGG - Intergenic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
928816354 2:35299295-35299317 AGAACTTAAGAGATGGAGCTTGG + Intergenic
928868055 2:35942091-35942113 AGGAATAAAAATATGAAGCTGGG - Intergenic
929394443 2:41506833-41506855 AGAGATAAAAAGAAGGAAGAGGG + Intergenic
929395150 2:41513989-41514011 GGAGATAAAAATTTGGAGCCAGG + Intergenic
929432661 2:41901584-41901606 GGAAAGAAAAAGATGGAGCCAGG - Intergenic
929774168 2:44917835-44917857 AGACATAATAAGATTCAGCTGGG - Intergenic
930001787 2:46866593-46866615 AAAGATAAGAAGCTGGAGGTTGG + Intergenic
930131167 2:47852331-47852353 AGAGAGAAAAGGATGGAGAGGGG + Intronic
930553536 2:52866813-52866835 ATAGATAGAAAGATAGAGATAGG - Intergenic
931072063 2:58663068-58663090 ATGGATAGAAAGATGGATCTTGG + Intergenic
931364151 2:61604080-61604102 AGTGATGAATAGATGGAGGTGGG + Intergenic
931609790 2:64086727-64086749 ACAGAGAAAAAGAGGGAGATGGG + Intergenic
931833854 2:66079027-66079049 AGAGAGAAAAACATGGAGCGGGG + Intergenic
931878204 2:66537543-66537565 AGAGAGAAAAAGATAGAGACAGG - Intronic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
932739432 2:74280441-74280463 AGAGATATAAAAATGGAACATGG - Intronic
932766100 2:74471168-74471190 AAAAAAAAAAAGATGGAACTGGG + Intergenic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
933568975 2:83985794-83985816 TTAGATATAAAGATGGAGATAGG - Intergenic
933941512 2:87248771-87248793 TGAGATTAAAAGGTGGAGGTGGG + Intergenic
935096142 2:99946169-99946191 AGTGGTAAAAAGATGGGGATGGG + Intronic
935263436 2:101374817-101374839 ATAGTTAAAAAGATGGAGGCTGG + Intronic
935452065 2:103221373-103221395 AGAAATACAAAGAGGGTGCTTGG + Intergenic
936338712 2:111612820-111612842 TGAGATTAAAAGGTGGAGGTGGG - Intergenic
936912784 2:117610160-117610182 AGAGAAAGAAAGAGGGAGGTTGG + Intergenic
937443939 2:121940839-121940861 GGAGATAAAAAGACTGCGCTTGG - Intergenic
937583748 2:123521374-123521396 ACAGATAAAAAGCTGGAGCACGG - Intergenic
937607815 2:123823191-123823213 AGAAATAAAAAGATTGACCAGGG + Intergenic
937742490 2:125372999-125373021 AGAGAGAAAAAAAAAGAGCTGGG - Intergenic
937981372 2:127618036-127618058 AGAGACAAATAGAGAGAGCTAGG - Intronic
938076784 2:128343746-128343768 AGAGACAAAGAGATAGAGCCTGG - Intergenic
938486934 2:131720962-131720984 ACAGATAAAGAGATGTAACTGGG - Intergenic
939416968 2:141912504-141912526 AGTGAAAAGAAGATGGAGCTAGG + Intronic
939874296 2:147559159-147559181 AGAGAAAAAAAGAAGAAGGTGGG - Intergenic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
940688955 2:156890524-156890546 AGAAGTAAAAAGATGAAGTTTGG + Intergenic
940843355 2:158610908-158610930 AGTGTTAAAAAGAATGAGCTTGG - Intronic
941003602 2:160225407-160225429 AGAGGCAAAACCATGGAGCTTGG - Intronic
941144365 2:161825312-161825334 AGAGATAAGAAACTAGAGCTAGG - Intronic
941321987 2:164067358-164067380 AGGGATAAGAAGGTGGGGCTGGG - Intergenic
941367946 2:164629547-164629569 AGAAAGAAAAAGATAGAGGTTGG - Intergenic
941568801 2:167142963-167142985 AGAGAGAAAAAGATGGAGAGAGG + Intronic
941939362 2:171017790-171017812 AGAGAAAAAAAGATGGATTCTGG + Intronic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942229779 2:173849544-173849566 ATAGATAAAACGATGGCGCAGGG - Intergenic
942989664 2:182184762-182184784 AGAGATAATAAGATGGGCCTTGG - Intronic
943331021 2:186559283-186559305 AGAGATAAGAAAATGGTTCTGGG + Intergenic
944223682 2:197327839-197327861 AGAGACACAAAGATACAGCTGGG + Intergenic
944354729 2:198773761-198773783 AGAGACAAAAAGGTGGGACTAGG + Intergenic
944407509 2:199401659-199401681 AGTGGTAAAAAGAGGGTGCTAGG + Intronic
944717885 2:202393253-202393275 AGAGATAAACAGACAGAGTTTGG + Intronic
945007264 2:205422107-205422129 TGTGATAGAAAGATGGGGCTGGG + Intronic
945135848 2:206626891-206626913 GGAGAGAAAAAGCTTGAGCTAGG + Intergenic
945793396 2:214332717-214332739 AAAGATAAAAAGATGGAGCGTGG - Intronic
946101597 2:217329923-217329945 AGGGATTAAAAGCTGGGGCTCGG + Intronic
946203806 2:218089190-218089212 AGAGATCAAAAGATAGAAATGGG - Intronic
946211855 2:218153603-218153625 TGAGATGAAAAGATAAAGCTTGG - Intergenic
946639054 2:221763649-221763671 AGAGGTCAGAAGATGGACCTTGG + Intergenic
946980727 2:225212532-225212554 AGGGAGAAAGAGATGGAGGTGGG + Intergenic
947094376 2:226549512-226549534 AGAGAGAAAACCATGGATCTTGG - Intergenic
947438039 2:230090241-230090263 AGAGATAAAAAGAGAGAGAGAGG + Intergenic
947461036 2:230305611-230305633 AGAGGTCCCAAGATGGAGCTGGG + Intronic
947529154 2:230897766-230897788 ATAGATAAATAGATGGAGTCTGG - Intergenic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948014283 2:234675213-234675235 AGAGTTAAGTAGATGGAGTTTGG + Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948394703 2:237636262-237636284 ACAGAAAAAATGATGGGGCTAGG - Intronic
949007430 2:241657721-241657743 AGAAAGAAGAAGATGGGGCTGGG - Intronic
1168974985 20:1958078-1958100 TGAGTTGAAGAGATGGAGCTGGG + Intergenic
1169151772 20:3295162-3295184 AGAAAAAAAAAGTGGGAGCTGGG - Intronic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169432401 20:5549848-5549870 AGAGAAAAAAAGATAGTTCTTGG + Intronic
1170407991 20:16059679-16059701 TCAGATAAAAAGATGGAACGTGG - Intergenic
1171136190 20:22696635-22696657 TGAGTTTAGAAGATGGAGCTGGG - Intergenic
1171402190 20:24881200-24881222 AGAGAGAAAGAGATGCATCTTGG - Intergenic
1171535249 20:25881669-25881691 AGAAATAAAAAGGTGGACCCTGG + Intergenic
1171823952 20:29878034-29878056 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1171896125 20:30812303-30812325 TGAGATGGAAGGATGGAGCTAGG + Intergenic
1172002982 20:31795114-31795136 AGAGTTGAAAACATGTAGCTGGG - Intronic
1172780676 20:37435357-37435379 TGAGAAAAAGAGAGGGAGCTAGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173040768 20:39460258-39460280 AGAGAGAAAGAGATGGGGCATGG + Intergenic
1173178340 20:40782520-40782542 AGAGAGAAAGAGACGGAGATGGG + Intergenic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174194710 20:48764805-48764827 AGAAAGAAAAAGAGGGAGGTAGG + Intronic
1174734447 20:52952334-52952356 AGAGAAAAATAGATGGGGCAGGG + Intergenic
1174859869 20:54081062-54081084 AGAGATAAAAGGAAGGGGCTGGG + Intergenic
1175352036 20:58329785-58329807 AGAGAGAAAAAGATGGGGGTAGG - Intronic
1177389509 21:20450044-20450066 AGATATAAAAAACTGGAGGTGGG - Intergenic
1177578391 21:22988100-22988122 AAAGATCAATAGATGGTGCTGGG + Intergenic
1177733982 21:25065222-25065244 AGTCATAAAAAGATGGTACTGGG - Intergenic
1178175249 21:30089716-30089738 AGAGAGAGAAAGATGGAGGTGGG - Intergenic
1178948077 21:36964799-36964821 ACATATAAAAACATGGAGATGGG - Intronic
1179366325 21:40761390-40761412 AGAGAAAAAAAGAGGGAGGGCGG - Intronic
1180491331 22:15851547-15851569 ACAGATAAAGAGATGTAACTGGG - Intergenic
1181413479 22:22742961-22742983 AGAGAGAAACACATGGAGGTTGG + Intronic
1182036362 22:27201478-27201500 AGAGAAAAAAAGATGCAACCCGG + Intergenic
1182375733 22:29846346-29846368 AAAGAAAAAAGAATGGAGCTAGG + Intergenic
1182967412 22:34535231-34535253 AGGGGTAAAAAGATGTAGCTCGG - Intergenic
1183005120 22:34894869-34894891 AGAGATAGAGAGAAGTAGCTGGG - Intergenic
1183205403 22:36415520-36415542 AGAGAGTAAATGATAGAGCTTGG + Intergenic
1183485410 22:38085505-38085527 AGAAAAAAAAAGATGAAGCGGGG - Intronic
1183514427 22:38255826-38255848 AAAGCTATAAAGATGGAGCATGG + Intronic
1184206850 22:43010161-43010183 AGAAATAATAAAATGGGGCTGGG - Intronic
1184984503 22:48120346-48120368 GGAAAGCAAAAGATGGAGCTGGG - Intergenic
949354448 3:3163413-3163435 AGACAAGAAAAGATAGAGCTGGG - Intronic
949774786 3:7620789-7620811 ACAGGCAAGAAGATGGAGCTTGG - Intronic
949823751 3:8142506-8142528 ACAGATAAATAGATGGAGATAGG + Intergenic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
951726336 3:25765162-25765184 CAAGATAAAAAGTTGCAGCTGGG + Intronic
951741105 3:25924588-25924610 GGAGCTCAAAAGATGAAGCTTGG + Intergenic
952132965 3:30385487-30385509 AGAGATTAGAGGATGGAGCAAGG - Intergenic
952160045 3:30684263-30684285 AGAAAAAAAAAAATGGAGGTTGG + Intronic
952259186 3:31723209-31723231 ACAGAGAAAAGGATGGAGATTGG + Intronic
952707166 3:36391195-36391217 AGAGATTGAAAGAGGGAGCAAGG - Intronic
953426578 3:42799749-42799771 AGCCAAAAAAAGATGGAGCCAGG - Intronic
953696714 3:45165599-45165621 AGAGATAAAAATATTGTGTTAGG - Intergenic
954078424 3:48197928-48197950 AGAGATAGAAAGTAGGGGCTGGG - Intergenic
954281892 3:49586321-49586343 ATAGATAGATAGATAGAGCTGGG - Intronic
954852301 3:53613995-53614017 ATAGATAATAAGATACAGCTAGG + Intronic
955039902 3:55306003-55306025 AGAGAGAACAGGATGGGGCTTGG + Intergenic
955495445 3:59527188-59527210 AGAGATAGAAAGTAGTAGCTGGG + Intergenic
955542635 3:59994026-59994048 AGAGACATAATGATGGTGCTTGG - Intronic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
956042407 3:65158350-65158372 AGAGAAAAAAAGAAGAAGTTAGG - Intergenic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
956877416 3:73477353-73477375 TGAGTTAAGAAGATGGATCTTGG - Intronic
957110680 3:75952775-75952797 AGCGATGAATAGATGGAGCAAGG - Intronic
958071549 3:88620256-88620278 TGAGATAAAATGAAGGAGATAGG - Intergenic
958266710 3:91446375-91446397 AGAGAGAAAAAGATGGATCTTGG + Intergenic
958649264 3:96916578-96916600 ATAGAAAAAAACAAGGAGCTGGG + Intronic
958722344 3:97859687-97859709 AGAGACAAAAAGGTGAAACTAGG - Intronic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960165187 3:114393506-114393528 AGGGGAAAGAAGATGGAGCTAGG - Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
960340088 3:116464156-116464178 ATAGTTATAAATATGGAGCTGGG + Intronic
960592652 3:119380549-119380571 AGAGGTAAAGAGATAGAGATAGG - Intronic
960806686 3:121590458-121590480 AGAGAGAGAAAGATAGAGGTGGG - Intergenic
961102279 3:124210007-124210029 AGGGTTAAGAAGATGGAGTTTGG + Intronic
961225100 3:125237033-125237055 AGAAATGAGAAGATGGAGATGGG + Intronic
961990668 3:131186759-131186781 ATAGATTAAAATATAGAGCTTGG + Intronic
963245159 3:143051381-143051403 AGAAAGAAAAAGATGGAGGCAGG + Intronic
963569789 3:146979018-146979040 AGAGATACAATGTTGGAGCTAGG - Intergenic
964216167 3:154285641-154285663 ATAGATAAAAATTTGAAGCTTGG - Intronic
964357184 3:155861612-155861634 GGAGAAAAAAAGAAGGAGGTGGG - Intergenic
964901425 3:161663750-161663772 AGAGTTGAAGAGATGGGGCTAGG + Intergenic
965491073 3:169337463-169337485 TGAGTTAAAAAGATGGAGGTTGG - Intronic
966186795 3:177234672-177234694 TAAGATAAAAAGCTAGAGCTGGG + Intergenic
966702347 3:182868685-182868707 AGTCAGAAAAACATGGAGCTGGG + Intronic
967050106 3:185775027-185775049 AAAAAAAAAAAGAGGGAGCTGGG + Intronic
967653400 3:192014889-192014911 AGAGACAGAGAGATGGGGCTTGG - Intergenic
968397847 4:260012-260034 AGAGATAAAAGAAGGCAGCTGGG - Intergenic
968766124 4:2470007-2470029 AGAGGGAAAAGGATAGAGCTTGG + Intronic
969166263 4:5318360-5318382 AGTGATAGGAAGATGGAGCAGGG + Intronic
969293078 4:6252950-6252972 AGAGATGGAAAGAGGGAGGTGGG - Intergenic
970029403 4:11658329-11658351 AGAGATAAGAGGTTGGAGCATGG + Intergenic
970285919 4:14514699-14514721 AGAGACAGAAAGATGGAGATGGG + Intergenic
970592185 4:17569283-17569305 AGAGATATAAAAATGGGTCTGGG + Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
970945466 4:21686207-21686229 AGAGGTAATAATATTGAGCTCGG + Intronic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971280342 4:25238115-25238137 AAAGATGAGAAGATGGAGCCTGG + Intronic
971873115 4:32270280-32270302 ATAGAGAAAAAAATGGAGATTGG + Intergenic
971920488 4:32933135-32933157 AGAGAGAGAAAGAGGGAGATTGG + Intergenic
972103681 4:35455223-35455245 AGTGGTAAAAAAATAGAGCTTGG + Intergenic
972309500 4:37866801-37866823 GGCGATATGAAGATGGAGCTTGG - Intergenic
972452126 4:39211982-39212004 AGAGATAGATAGATGTAGATAGG + Intronic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
972727236 4:41755627-41755649 AGAGAGCAAAAGAGGGAGATTGG - Intergenic
972906591 4:43756209-43756231 GGAGATAAAAAGAAGGAAATGGG - Intergenic
973153750 4:46922265-46922287 AGATATAAAAATATGGTGCCTGG + Exonic
973628476 4:52795891-52795913 AGAGAAAAACAGATTCAGCTGGG + Intergenic
973868111 4:55135294-55135316 AGAGATTAGAGGCTGGAGCTAGG - Intergenic
974092530 4:57327113-57327135 AGTGAGATAAAGATGGATCTTGG + Intergenic
975028314 4:69579887-69579909 AGAGGAAAAAAAATTGAGCTGGG - Intergenic
975423217 4:74194277-74194299 AGAGATCAAAAGATGAAGTTTGG - Intronic
976432230 4:84975621-84975643 AGAGAAAAAAAAATGGAGATTGG - Intergenic
976644988 4:87377991-87378013 GGCTATTAAAAGATGGAGCTGGG + Intronic
976768660 4:88626340-88626362 AGTAATAAAAACATGGAGCCAGG - Intronic
978102320 4:104857507-104857529 AGAGACAGAAAGATGGGGGTGGG + Intergenic
978414172 4:108458299-108458321 AGGGATAAGCACATGGAGCTGGG + Intergenic
979946715 4:126842094-126842116 AGAGTTAAAAATATGGACATGGG - Intergenic
980011869 4:127604929-127604951 AAAGAAATAAAGAAGGAGCTAGG + Intergenic
980100505 4:128536974-128536996 AGAGAGAAAGGGATGGAGCGAGG + Intergenic
980112127 4:128645516-128645538 AGAGATAAGAGGTTGGAGCATGG + Intergenic
980451187 4:132974113-132974135 AGAGATAGAAAGAGGCAGCCAGG + Intergenic
980569618 4:134597455-134597477 AAAGATAAATAGATGGGACTTGG + Intergenic
981324013 4:143426092-143426114 AAAGATAAAAAGTTAGAGGTTGG + Intronic
981552495 4:145956346-145956368 GGTGATAGAAAGATGCAGCTGGG - Intergenic
981771268 4:148311426-148311448 AGAGAGAAAAAGATGGCTCCGGG - Intronic
982167634 4:152629165-152629187 AGAGAGAACCAGATGGAGTTGGG + Intronic
982621656 4:157714745-157714767 AGAGAAAAAAAAATGAAGCAAGG + Intergenic
983182254 4:164662282-164662304 AGACCTATAAAGATGGAGATGGG + Intergenic
983201659 4:164867131-164867153 AAAGCTATAAAGAGGGAGCTTGG - Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984996171 4:185432565-185432587 ATAGATAAAAATATGAGGCTGGG + Intronic
986054015 5:4118183-4118205 AGAGAAAAAAATATGCAGCTTGG - Intergenic
986540626 5:8840637-8840659 AGAGAGAAAGAGACGGAGATCGG - Intergenic
986666522 5:10109332-10109354 ATAAATAAAAAGAAAGAGCTGGG - Intergenic
986777081 5:11026046-11026068 AGAGAGAAATGGATGGAGGTAGG + Intronic
986811235 5:11361704-11361726 AGATAGAAAAAGATGGTGGTAGG - Intronic
987324301 5:16798463-16798485 AGAAAAAAAAAGATGGAAGTTGG + Intronic
987380499 5:17281020-17281042 TGAGATAAAAAGATAGGGCCAGG - Intergenic
987481684 5:18467005-18467027 AGAGTTTAAAAGGTTGAGCTAGG + Intergenic
988222018 5:28358928-28358950 AGAAATAAGAAGATTGGGCTGGG + Intergenic
988286404 5:29223892-29223914 AGAGATTAAAAGTTGGATATTGG - Intergenic
988290787 5:29282977-29282999 AGAGATATAAAGGTAGAGCATGG - Intergenic
988360015 5:30225239-30225261 AGAGATAGTCAGATTGAGCTAGG - Intergenic
989074749 5:37552070-37552092 ATAAAAAAAAATATGGAGCTCGG - Intronic
990516060 5:56531845-56531867 AGTGACAGAAAGATGGAGCATGG - Intronic
990930137 5:61079827-61079849 TAAGTTAAGAAGATGGAGCTGGG - Intronic
991561598 5:67959222-67959244 CCAGAAAAAAAGATGTAGCTTGG - Intergenic
991978388 5:72205693-72205715 AGAGAGAAAAAGAGAGAGCAGGG + Exonic
991981539 5:72236642-72236664 AGCGAGTAAAAGATTGAGCTAGG - Intronic
992252830 5:74892795-74892817 AGAAACAAAAAGGTGGGGCTTGG - Intergenic
993256562 5:85598452-85598474 AGAAATAAAAAGATAGAACATGG - Intergenic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
994722204 5:103393188-103393210 ATAGATAAAAAGGTGGGGGTGGG + Intergenic
995389593 5:111625931-111625953 TGAGTTAAAGAGATGAAGCTGGG + Intergenic
995486826 5:112647810-112647832 AGAGAGAAAAACATGAAGCCTGG - Intergenic
995931279 5:117448927-117448949 TGAGAAAAATAGATGAAGCTTGG + Intergenic
997329544 5:133049811-133049833 TGAGATAAACAGATGGAGACAGG + Intergenic
997523167 5:134536154-134536176 AGAGCAAAACAAATGGAGCTGGG - Intronic
997772858 5:136570118-136570140 AGAGATAAGAAGTTGGGGCATGG + Intergenic
997941891 5:138165373-138165395 AGGGCTACAAAGATGGAGATGGG + Intronic
998148906 5:139746077-139746099 AGAGACAGAGAGGTGGAGCTTGG - Intergenic
998549486 5:143063663-143063685 AAAGGTAAAAGGATGGAGCAGGG - Intronic
998553309 5:143098639-143098661 AGAGAAAAAAACATGAAGATTGG + Intronic
998788137 5:145734949-145734971 ACAGATAAAAAGCTACAGCTGGG + Intronic
999078849 5:148824708-148824730 AAAGATTAAAAGATGGGTCTTGG + Intergenic
999191368 5:149749947-149749969 ACAGATGGACAGATGGAGCTAGG + Intronic
999528829 5:152438972-152438994 AGAGTTAAAAAACTGGGGCTGGG + Intergenic
999797705 5:155003777-155003799 GGAGATAAAAGGATAGAGATAGG - Intergenic
999903563 5:156114003-156114025 AGGGATAAATAGATGGAGCCAGG + Intronic
1001866488 5:175110440-175110462 AGAGATAAGAAGCTGAGGCTGGG - Intergenic
1001925534 5:175633475-175633497 AGACAGACAAACATGGAGCTTGG + Intergenic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002597389 5:180333191-180333213 AGATATAAAAAAATGGAGAAGGG - Intronic
1002947364 6:1775932-1775954 AGAAATAAAAAAAGGGAGATGGG + Intronic
1003166264 6:3681457-3681479 AGAAACAAAAAGAAGGACCTAGG - Intergenic
1003167126 6:3690030-3690052 AGAGATAAATAGGAGGAGCGGGG - Intergenic
1003417488 6:5925091-5925113 TGTGATAAAAAGAATGAGCTTGG - Intergenic
1003507219 6:6750038-6750060 AGAGCTGAAAAGCTGCAGCTGGG - Intergenic
1003747266 6:9016590-9016612 GGAGATGAAAAGTTGGAGCAAGG + Intergenic
1003953763 6:11143194-11143216 AGAGATAGAAATATGGAGCCAGG - Intergenic
1004843269 6:19611493-19611515 AGATAATAAATGATGGAGCTGGG + Intergenic
1005308753 6:24538899-24538921 AAAGAAAAAAACGTGGAGCTAGG + Intergenic
1005614694 6:27561355-27561377 AGAAATACAAAGCTGGAGCCGGG - Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1006445666 6:34078500-34078522 TGAGATAGAAAGGTGGAGGTGGG - Intronic
1007187120 6:39981366-39981388 ACAGATAAGAAGATGGGGGTGGG + Intergenic
1007555923 6:42766293-42766315 AGAGATGAAGAGTTGGAGCCAGG + Intronic
1007635077 6:43294867-43294889 AGAGATGAGAGGATGGGGCTAGG - Intergenic
1008821554 6:55638119-55638141 AGAAATAAAAAGTTATAGCTGGG + Intergenic
1009038965 6:58154698-58154720 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1009177110 6:60473809-60473831 AGAGAGAAAAAGATGGATCTTGG - Intergenic
1009214861 6:60909534-60909556 AAAGAAAAAAAAATTGAGCTGGG - Intergenic
1010132828 6:72515003-72515025 AGCAATTAAAAGATGGAGATTGG - Intergenic
1010371383 6:75112415-75112437 AGAAATAAAAAGAACGATCTAGG - Intronic
1011002188 6:82603599-82603621 ATAGAACAAAAGATGGAGCCAGG - Intergenic
1011430098 6:87276406-87276428 AAAGAAAAAAAAATGTAGCTAGG - Intergenic
1011486306 6:87845554-87845576 GGAGATAAAAATATGGTGTTAGG + Intergenic
1011967274 6:93174491-93174513 AGAGATAAAAAGAAGAAGAAAGG + Intergenic
1012808086 6:103921312-103921334 AGACATTAAAAGATTTAGCTAGG + Intergenic
1013339230 6:109197041-109197063 AGAGATACAAAGATAGAACTTGG - Intergenic
1014281137 6:119443557-119443579 AGAAAAAAAAAAATGGAGCATGG - Intergenic
1014619762 6:123652331-123652353 AGAGAGAAAAAGTTGGGGGTGGG - Intergenic
1015323665 6:131902827-131902849 AGAGATAAGAGGTTGGAGCATGG - Intergenic
1015717980 6:136211640-136211662 AGAGAGTCAAACATGGAGCTGGG + Intergenic
1016248641 6:142016774-142016796 AGAGATAAGAGGTTGGGGCTTGG - Intergenic
1016248651 6:142016816-142016838 AGAGATAAGAGGTTGGGGCTTGG - Intergenic
1016650482 6:146455082-146455104 AGAGATAAGAGGTTGGGGCTCGG + Intergenic
1016758443 6:147712457-147712479 AGCGGAAAAAACATGGAGCTAGG - Intronic
1016792567 6:148080723-148080745 AGAGATAAAATGATGGTGAAAGG - Intergenic
1016960058 6:149664848-149664870 AGAGACAAAAAAATGGAGCTGGG - Intronic
1016976712 6:149815876-149815898 TCAGTTAAAAAGATGAAGCTGGG - Intergenic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017080382 6:150662704-150662726 ACACATTTAAAGATGGAGCTTGG - Intronic
1018435614 6:163755769-163755791 ACAGATAGAAAGATGAGGCTTGG - Intergenic
1018633462 6:165840240-165840262 AGGGAGATAAGGATGGAGCTGGG - Intronic
1019154201 6:170028149-170028171 AGAGAGACAAAGATGGAGAGAGG + Intergenic
1020695661 7:11410833-11410855 AGAGAATAAATGATGGACCTTGG + Intronic
1021039506 7:15844477-15844499 TGAGATGATAAGATGGATCTGGG - Intergenic
1021301603 7:18980119-18980141 AGAGATAAAATGATGGCCCTGGG - Intronic
1022006032 7:26266499-26266521 ACAGAAAAAAAGTTGGAGCCAGG + Intergenic
1022317465 7:29258857-29258879 AAAGATAGAAAGATGGAAGTGGG - Intronic
1022823506 7:33984930-33984952 AGAGATATAAAGATGGAAAGAGG - Intronic
1023652089 7:42382058-42382080 AGCCAGAACAAGATGGAGCTTGG - Intergenic
1024100051 7:46022635-46022657 ATAGATCAAAAGATGAAGCAGGG - Intergenic
1024124755 7:46281937-46281959 AAAAAAAAAAAGATAGAGCTGGG + Intergenic
1024236254 7:47401450-47401472 AGAGATACAAAGAAGGAGGAAGG + Intronic
1025200497 7:56958492-56958514 AGAGATAAAAAGGGGCAGCGGGG + Intergenic
1025223169 7:57133569-57133591 AAAAAGAAAAAGGTGGAGCTGGG + Intronic
1025671447 7:63618440-63618462 AGAGATAAAAAGGGGCAGCGGGG - Intergenic
1025714003 7:63937682-63937704 AGAAACAAAATGATGGAGCAGGG + Intergenic
1026008539 7:66618699-66618721 AGAGATGTAAGGATTGAGCTAGG + Intergenic
1026051205 7:66948263-66948285 AGAGATGAAAAGCTCGGGCTGGG - Intronic
1026284942 7:68954879-68954901 AGAGATAAAAAAAGAGAGCAAGG + Intergenic
1027619856 7:80471080-80471102 AGAGATAGAAAGATGTAGGCTGG - Intronic
1027663408 7:81015354-81015376 AGAGAGAACAAGGTGGGGCTGGG + Intergenic
1028068364 7:86417119-86417141 AGAGAGAACAAAATGGATCTTGG - Intergenic
1028078445 7:86544382-86544404 AATGATAAAAACATGGGGCTTGG + Intergenic
1028255964 7:88598005-88598027 AGAGACAGAAAGATGTACCTGGG + Intergenic
1028313422 7:89368576-89368598 TGAGATAAAAAAATGGAGTTTGG - Intergenic
1028741325 7:94278989-94279011 AGAGAAAGAAAGAAGGAACTAGG + Intergenic
1028748731 7:94357662-94357684 AGAGGTAAAAAGAGGTGGCTGGG - Intergenic
1028881119 7:95880956-95880978 AAAGATAAAAAAATGGAGGGAGG - Intronic
1028940513 7:96517076-96517098 AGAGACAAATAGGTGGAGCATGG + Intronic
1028979210 7:96948461-96948483 AGAGATAGAAAAGTGGAGCTGGG - Intergenic
1030319760 7:108152936-108152958 ACAGAGAAAAAGATGGTGCCAGG + Intronic
1031391034 7:121215197-121215219 AGAGCCAAAAGGATGGAGCTGGG - Intronic
1031480547 7:122273602-122273624 AAAGATAAAAAGATAAACCTGGG + Intergenic
1032282587 7:130516552-130516574 AGAGAACAAAAGATGGAGGTTGG + Intronic
1033039071 7:137901890-137901912 AAAGAAAAATAGAAGGAGCTGGG + Intronic
1033265568 7:139883609-139883631 AGAGAAAGAAAGTTGAAGCTGGG - Intronic
1033391426 7:140931965-140931987 GGAAATAAAAAAATGGAACTAGG - Intergenic
1033942572 7:146674380-146674402 AGAAATAAGAAAATGGAGGTGGG + Intronic
1034186734 7:149183775-149183797 ACAGATAAAGAACTGGAGCTAGG - Intergenic
1034352152 7:150423675-150423697 AGGGATAAATAGGTGGAGCACGG - Intergenic
1034485953 7:151362662-151362684 GGAGTTAAAGAGATGGAGCTGGG + Intronic
1036988739 8:13567427-13567449 AGACATAAAAAGCTGCATCTTGG + Exonic
1037094002 8:14961191-14961213 AAAAAGAAAATGATGGAGCTGGG - Intronic
1037216925 8:16465728-16465750 AGAAATAAAGAGATGTAGATGGG + Intronic
1037231465 8:16663938-16663960 AAAGATAAAAGGATTGACCTTGG + Intergenic
1037387733 8:18361362-18361384 AGAGAGAGAAAGAAGAAGCTAGG + Intergenic
1037547626 8:19939737-19939759 AGAGAGAAAAAGCGGGAACTGGG - Intronic
1037616417 8:20523029-20523051 AGAGACAGACAGATGGACCTAGG + Intergenic
1038479978 8:27895151-27895173 AGAAATAAACACATGGGGCTGGG + Intronic
1039845128 8:41320620-41320642 AGAGAGAAAGAGAGGGAGGTGGG - Intergenic
1040462200 8:47659711-47659733 AGAGAGAAAAAAAGGGAGCATGG - Intronic
1040618471 8:49063422-49063444 AAAGATATAAAGAATGAGCTGGG + Intronic
1041268629 8:56089217-56089239 AGAGATAATGAGATGGATCAAGG - Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041813949 8:61945368-61945390 AGAGATAAAAAGATGGGGAGGGG + Intergenic
1043049456 8:75366716-75366738 AGACATAAGATGATGGAGGTAGG + Intergenic
1043163464 8:76874050-76874072 AGAGACAAAAAGAGAGAGCAAGG - Intergenic
1044418380 8:91962197-91962219 AGAAATAAGAACGTGGAGCTGGG - Intronic
1044511020 8:93079122-93079144 ACAGATAAAGAAGTGGAGCTGGG - Intergenic
1044513874 8:93116096-93116118 TCAGTTAAAGAGATGGAGCTGGG - Intergenic
1044763904 8:95551219-95551241 AGAGAAAAAAAGATTGAGTATGG - Intergenic
1044920973 8:97169185-97169207 AGAGAACATAAGATGGAGCTGGG - Intergenic
1045197327 8:99944933-99944955 AGAGATAAGAGGATGGGGCATGG - Intergenic
1045575194 8:103413067-103413089 ACAGATAAAAGGATTGAGTTTGG - Intronic
1045832851 8:106485172-106485194 AGAGATAAACAGGTAGAGCATGG + Intronic
1046027564 8:108744008-108744030 AGAGAATAAAAGAAGGAGGTGGG + Intronic
1046693011 8:117307250-117307272 AGAAATTAAAAGGTGGAACTGGG + Intergenic
1047552909 8:125895946-125895968 AGAGAGGGAAATATGGAGCTAGG - Intergenic
1047710731 8:127549836-127549858 AGATATAAGATGTTGGAGCTGGG - Intergenic
1047734014 8:127750166-127750188 AGAGAGAAAAAGAGGGAGAAGGG - Intergenic
1048026737 8:130593929-130593951 AGAGAGAAAAGGATTGAGCCAGG + Intergenic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048433041 8:134388516-134388538 AGAGAAAAAAAGATTGGGGTAGG + Intergenic
1049127382 8:140804290-140804312 AAAGAAAAAAAGATAGAGTTGGG + Intronic
1049350738 8:142163249-142163271 AGAGAGATGAAGATGGAGCATGG + Intergenic
1049350842 8:142163810-142163832 AGAGAGATGAAGATGGAGCATGG + Intergenic
1049974706 9:850293-850315 AGAGACAGAAAGATGGAGTGTGG + Intronic
1050849696 9:10268104-10268126 AAAAAAAAAAAGATGGAGATGGG - Intronic
1051713693 9:19959193-19959215 GGAGAGAAAAAGAGGGACCTGGG + Intergenic
1051735492 9:20194059-20194081 TCAGAGAAAAAGATTGAGCTGGG + Intergenic
1051764343 9:20506056-20506078 AGAGAAAAAAAGAAAGAGCAGGG - Intronic
1052916260 9:33926314-33926336 AGAGAAAACAAGATGGAGGAGGG + Intronic
1053328307 9:37177361-37177383 AAAAATAAAAGCATGGAGCTAGG + Intronic
1053440387 9:38111428-38111450 AGAAGTAAAATTATGGAGCTGGG - Intergenic
1054337096 9:63817131-63817153 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1054450107 9:65398864-65398886 GTAGATAATAAGAGGGAGCTAGG + Intergenic
1055196221 9:73597571-73597593 AGAGAAAAAGAGAAGGAGCTAGG + Intergenic
1055468769 9:76591170-76591192 AGAGAAAAAAAGATGGAGATGGG + Intergenic
1055468783 9:76591273-76591295 AGAGAAAAAAAGATGGAGATGGG + Intergenic
1055797037 9:79985894-79985916 AAAGAGAGAAAGATGGAGTTAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056673690 9:88654717-88654739 AGAGAAATAAAGAAGGAGCCTGG + Intergenic
1057246918 9:93464300-93464322 TGAGATAAAAAGATTTACCTAGG + Intronic
1057673731 9:97120161-97120183 ATTGATCAAAAGATGGAGATTGG + Intergenic
1057673770 9:97120448-97120470 AAAAAAAAAAAGATGGAGATTGG + Intergenic
1058218562 9:102266323-102266345 ATAGATAGATAGATGGTGCTGGG + Intergenic
1059539521 9:115116866-115116888 TGAGATAAAAAGCGGGGGCTGGG + Intronic
1059919485 9:119142146-119142168 AGAGAGAGAAAGAGGGAGCGAGG - Intergenic
1059965140 9:119606338-119606360 AGAGAAAAAAAAAAGAAGCTTGG - Intergenic
1060408756 9:123386064-123386086 AGAGACGATATGATGGAGCTGGG + Intronic
1060543266 9:124446086-124446108 ACAGAGAAAAAGATGGAGTCTGG + Intergenic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061512762 9:131071084-131071106 TCTGATGAAAAGATGGAGCTAGG + Intronic
1062251207 9:135595526-135595548 AGTAATAAAAAGGTGGAGGTAGG + Intergenic
1203377033 Un_KI270442v1:384552-384574 TGAGATGGAAGGATGGAGCTAGG - Intergenic
1185604500 X:1360164-1360186 AGAGAGAGAAAGATGGAGGGAGG - Intronic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187980056 X:24747150-24747172 AGAAAAAAAAAAAAGGAGCTTGG - Intronic
1188460745 X:30424369-30424391 AGAAATTCAAGGATGGAGCTGGG - Intergenic
1188750281 X:33896577-33896599 AGAGATAAAGAGAGGGAGGGAGG - Intergenic
1188919051 X:35948942-35948964 AGAATTAAAAAGATGGAGGTGGG + Intronic
1189566220 X:42244091-42244113 AGAGAGAGAGAGATGGAGGTGGG + Intergenic
1189767299 X:44384710-44384732 AGAGAAATAGAGAGGGAGCTGGG - Intergenic
1190185060 X:48226452-48226474 ACAGACAAAATAATGGAGCTCGG + Intronic
1190281334 X:48932646-48932668 AGAAAGAAAAAGAGGAAGCTGGG + Intronic
1190415070 X:50172814-50172836 AGAGAGAAGAATTTGGAGCTTGG + Intergenic
1190908201 X:54748964-54748986 AGACATAAAAAGATGGGGACAGG - Exonic
1191007871 X:55729572-55729594 ACAGATACCTAGATGGAGCTTGG - Intronic
1193170468 X:78329843-78329865 AAAGATAAAGAGATGAAGCAAGG - Intergenic
1193243698 X:79204011-79204033 AAAAATAAAAAAATAGAGCTGGG + Intergenic
1193337957 X:80312985-80313007 AGAGGGAAAAAGAGGGAGCAAGG - Intergenic
1194973099 X:100365860-100365882 AGAACTAACAAGAAGGAGCTGGG - Intronic
1195196731 X:102504179-102504201 ACAAATTAAAAGATGGAGATTGG + Intergenic
1195388067 X:104332374-104332396 AGAGAAAAAGTGATGGAGGTTGG + Intergenic
1195640739 X:107172026-107172048 AGAAATAAAAAGATGAGGCCAGG + Intronic
1196362839 X:114886877-114886899 ACAGCTAAAAAGATGTAGGTGGG - Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1198459051 X:136846233-136846255 AGAAAAAAAAAGGTGGGGCTGGG - Intergenic
1198558769 X:137825380-137825402 AAAGAAAAAAATATGGAGTTAGG + Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1199179257 X:144834341-144834363 AGAAATAAAAAGAATGGGCTGGG + Intergenic
1199577311 X:149324746-149324768 AGAGAGAAATAGATGGATATAGG + Intergenic
1199850856 X:151724240-151724262 AGAGAGAAAGAGGTGGAGCAGGG - Intergenic
1199871020 X:151899063-151899085 AGAAGAAAAAAGATGGAGCCAGG - Intergenic
1200582696 Y:4969702-4969724 ACAGAAACAAAGATGGAGCAAGG + Intergenic
1201435004 Y:13948533-13948555 ACAGAAAAAATGATGGAGTTGGG + Intergenic