ID: 972520944

View in Genome Browser
Species Human (GRCh38)
Location 4:39856015-39856037
Sequence GACCCTGATGTGTCTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972520944_972520946 9 Left 972520944 4:39856015-39856037 CCACACTGAGACACATCAGGGTC 0: 1
1: 0
2: 2
3: 34
4: 221
Right 972520946 4:39856047-39856069 AACATTTGATAAAGAGATAAAGG 0: 1
1: 2
2: 12
3: 65
4: 576
972520944_972520947 16 Left 972520944 4:39856015-39856037 CCACACTGAGACACATCAGGGTC 0: 1
1: 0
2: 2
3: 34
4: 221
Right 972520947 4:39856054-39856076 GATAAAGAGATAAAGGATAAAGG 0: 1
1: 0
2: 5
3: 71
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972520944 Original CRISPR GACCCTGATGTGTCTCAGTG TGG (reversed) Intronic
900188379 1:1343280-1343302 GGCCCTGAGGAGTCCCAGTGTGG - Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
902758504 1:18565433-18565455 GACACTGATGTGGCTGAGAGAGG + Intergenic
904633822 1:31864189-31864211 GACCCTGGTGCTTCTCTGTGTGG - Intergenic
904860912 1:33537050-33537072 GACCCTGGTGTGCCACAGTTTGG - Exonic
906141496 1:43536486-43536508 GACCCTGCTGTGGCTGGGTGTGG + Intronic
910152116 1:84162244-84162266 GACTATGATATGTCTCAGTGTGG + Intronic
910575158 1:88754044-88754066 TACCATGATGTGTCCAAGTGTGG + Intronic
911363299 1:96906219-96906241 GACCCTGATCTGCTTCAGGGAGG - Intergenic
916595469 1:166238135-166238157 AACTATGATGTGTCTGAGTGTGG + Intergenic
916927953 1:169542645-169542667 GCCAATGAGGTGTCTCAGTGGGG + Exonic
919595787 1:199560658-199560680 CACCCTGATTTGTCTAGGTGTGG - Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920261491 1:204691102-204691124 GCCTATGATGGGTCTCAGTGAGG - Intergenic
921633913 1:217468783-217468805 CACACTGATGTATTTCAGTGGGG + Intronic
922788410 1:228295264-228295286 GACCCTGATGTCTGTCTGTGGGG - Intronic
923703506 1:236322827-236322849 TATCATAATGTGTCTCAGTGTGG - Intergenic
924497329 1:244602910-244602932 GACCCTGATGTTTCCATGTGTGG - Intronic
1064435145 10:15304632-15304654 GGCCCTGGTGTTTCTCTGTGTGG + Intronic
1065607463 10:27433192-27433214 GACTATGATGTGCCTAAGTGTGG - Intergenic
1066067374 10:31772182-31772204 GGCACTGATGTGTCTCAATCTGG - Intergenic
1067480820 10:46596542-46596564 GACCCAGGTTTGTCTCAGAGTGG - Intergenic
1067613919 10:47745259-47745281 GACCCAGGTTTGTCTCAGAGTGG + Intergenic
1069413114 10:68173201-68173223 AAGCCGGATGTGTCTCAGAGAGG - Intronic
1069416351 10:68204350-68204372 CACCCTAATGTGTCTCTCTGCGG + Intronic
1071629325 10:87205236-87205258 GACCCAGGTTTGTCTCAGAGTGG + Intergenic
1073046969 10:100645184-100645206 GAGCCTGTTGTCTCTCTGTGGGG + Intergenic
1073541301 10:104317990-104318012 CACCCTGAGGATTCTCAGTGTGG + Intronic
1073906463 10:108286490-108286512 GATTCTAATGTGTCTTAGTGTGG + Intergenic
1075026204 10:118985305-118985327 GATTGTAATGTGTCTCAGTGTGG - Intergenic
1076605675 10:131688683-131688705 GCACATGATGTGTGTCAGTGGGG - Intergenic
1077180630 11:1211851-1211873 GATTATAATGTGTCTCAGTGTGG - Intergenic
1078954857 11:16181009-16181031 GACCCAGATGTGTCTGTGTGGGG + Intronic
1079101232 11:17543621-17543643 CACCCTGGTGTGTCCCAGTGAGG - Intronic
1079828022 11:25223707-25223729 GATTATAATGTGTCTCAGTGGGG + Intergenic
1082659596 11:55894402-55894424 GACAAAGATGTGTCTCAGGGGGG - Intergenic
1083228172 11:61297727-61297749 GACCCTGAGGTTTCTCAGTTTGG + Intergenic
1084886344 11:72210126-72210148 GATTATGATGTGTCTCGGTGTGG - Intergenic
1088998199 11:115022419-115022441 GATTATGATGTGTCTCAGTGTGG - Intergenic
1090184743 11:124729825-124729847 GACCCTGAAATGTCTAAGTTGGG - Intergenic
1090423318 11:126590529-126590551 GGCCCTGCTGTGGCTCACTGTGG + Intronic
1092108445 12:5941685-5941707 GACTCTGATGTATCTAGGTGTGG - Intronic
1094281588 12:28746008-28746030 GACTCTGATGTGTCTACGAGTGG + Intergenic
1095750184 12:45701888-45701910 CACTATGATGTGTCTAAGTGTGG + Intergenic
1100581498 12:95943739-95943761 GACCCTGATGCGTTCCAATGGGG - Intronic
1100639608 12:96469763-96469785 GACCGTGATGTGTCTTGGTGTGG + Intergenic
1101097580 12:101358957-101358979 GATCATGATGTGTCTAAGTGTGG + Intronic
1101268434 12:103116712-103116734 GAACCTAATGAGACTCAGTGAGG - Intergenic
1101290279 12:103361254-103361276 GACCTTGAGGTTCCTCAGTGAGG - Intronic
1101681850 12:106975997-106976019 CACTCTGAAGTGTCTCAGTTGGG - Intronic
1105034416 12:132908483-132908505 GACCCGGATGGGTCCCAGAGGGG + Intronic
1105286934 13:19012148-19012170 CTCCCTCATGTGTCTCACTGTGG - Intergenic
1105466581 13:20647884-20647906 GATCATAATGTGTCTCATTGTGG - Intronic
1111402565 13:87760206-87760228 TATCCTGATGTAACTCAGTGGGG - Intergenic
1111461755 13:88553468-88553490 GACTATAATGTGTCTCAGAGTGG + Intergenic
1111911104 13:94312996-94313018 GAAACTGGGGTGTCTCAGTGGGG - Intronic
1113902792 13:113805970-113805992 CACCGTGATGTGTTTCTGTGCGG + Intronic
1114909558 14:27173121-27173143 GACTATAATGTGTCTGAGTGTGG + Intergenic
1116468324 14:45258405-45258427 GATTATAATGTGTCTCAGTGTGG + Intergenic
1118107258 14:62673925-62673947 GACCCTGAAGTATGGCAGTGGGG - Intergenic
1118518427 14:66552902-66552924 GATTCTAATGTATCTCAGTGTGG + Intronic
1118999748 14:70871445-70871467 GACAAGAATGTGTCTCAGTGGGG + Intergenic
1120487942 14:85138287-85138309 TGCCCTCATGTGTCTCTGTGTGG + Intergenic
1120497177 14:85252114-85252136 TACCTTGATGTGTCTTAGTTTGG + Intergenic
1120736818 14:88062588-88062610 GACTCTGATGTGTCTTGCTGTGG - Intergenic
1120850903 14:89168796-89168818 GACTGTGATGTGTCTCCGTATGG - Intronic
1121513161 14:94528975-94528997 CTCCCTGAGGTGCCTCAGTGGGG - Intergenic
1122715214 14:103692913-103692935 AAACCTGATGTGTCTGTGTGAGG - Intergenic
1122773808 14:104108473-104108495 GGCCCTGCTGTGCCTGAGTGGGG + Intronic
1123705633 15:22949100-22949122 GACCGTGATGTGTCTGGGTGTGG - Intronic
1124417817 15:29488602-29488624 GATTATAATGTGTCTCAGTGTGG - Intronic
1125275852 15:37991409-37991431 GATTATAATGTGTCTCAGTGTGG + Intergenic
1126109034 15:45165072-45165094 GACCAGGATGTGTCTCAGCCTGG + Exonic
1128284189 15:66422678-66422700 GACTATGATGTGTCTAGGTGTGG + Intronic
1130392539 15:83471853-83471875 GACTATGATGTGTCTTGGTGTGG + Intronic
1132118679 15:99158165-99158187 GTCCCTCATGTACCTCAGTGGGG - Intronic
1132350976 15:101139552-101139574 GACCCTCATGTGAGTCAGCGAGG + Intergenic
1132421363 15:101672768-101672790 GCCCCGGAAGTGTCTCCGTGGGG - Intronic
1132842717 16:1986113-1986135 GAGCCTGTTGTGTCTCAGTTGGG + Exonic
1133414849 16:5598350-5598372 GGTCCGGATGTTTCTCAGTGTGG - Intergenic
1135973774 16:27091721-27091743 GACTGTGATGTGTCTTGGTGTGG - Intergenic
1138930524 16:61649839-61649861 AACTCTGTTGAGTCTCAGTGTGG + Exonic
1141477012 16:84280841-84280863 GAACGTGATGTGTATCAGTCAGG + Intergenic
1141799702 16:86298450-86298472 GACCTTCATGTTTCTCAGCGGGG - Intergenic
1143032044 17:3973275-3973297 GAGCTGGATGTGTCTCAGTGTGG - Intergenic
1143032052 17:3973319-3973341 GAGCTGGATGTGGCTCAGTGTGG - Intergenic
1143032079 17:3973445-3973467 GAGCTGGATGTGGCTCAGTGTGG - Intergenic
1143032087 17:3973486-3973508 GAGCTGGATGTGTCTCAGTGTGG - Intergenic
1143032095 17:3973530-3973552 GAGCTGGATGTGGCTCAGTGTGG - Intergenic
1143032113 17:3973611-3973633 GAGCGGGATGTGTCTCACTGTGG - Intergenic
1143032128 17:3973693-3973715 GGTCTGGATGTGTCTCAGTGTGG - Intergenic
1143032135 17:3973732-3973754 GGTCTGGATGTGTCTCAGTGTGG - Intergenic
1143699629 17:8648597-8648619 GATGCTGGTGTGTTTCAGTGGGG + Intergenic
1144195665 17:12892393-12892415 GACCATGATGTGTCTTGGTGAGG + Intronic
1145045632 17:19613143-19613165 GACATTGCTGTGTCTCAGTCTGG + Intergenic
1145117655 17:20226261-20226283 TAGCATGATGTGTATCAGTGTGG + Intronic
1146276202 17:31517329-31517351 GACCCTATTCTGCCTCAGTGGGG + Intronic
1146693810 17:34893971-34893993 GACCCTGAGATGGCTCAGGGAGG - Intergenic
1146729671 17:35182878-35182900 TGCCCTGATATGTCTCAGAGAGG - Intronic
1147533855 17:41305091-41305113 GATCATGATATGTCTCAATGTGG - Intergenic
1148836797 17:50469723-50469745 GCCCCTGAGGGGTCTCAGGGTGG + Intronic
1148893379 17:50824105-50824127 GACCCTGAGGTGGCTGGGTGTGG + Intergenic
1149514415 17:57269309-57269331 GAACCTGTTGTGTGTCTGTGCGG + Intronic
1150628672 17:66860327-66860349 GACTATGATGTGTCTGGGTGTGG - Intronic
1152391911 17:80008477-80008499 GTCCCAGTTGTGTCTCAGAGAGG - Intronic
1153060386 18:989015-989037 GACACTGATGTGGGACAGTGAGG + Intergenic
1155233019 18:23793016-23793038 GACCCTGATGCTTCTCCATGTGG - Intronic
1155620405 18:27771775-27771797 GACCCTGAAGTTTCTCACTTTGG + Intergenic
1155737807 18:29245824-29245846 TACCCTGCTGTGTCACAGTCTGG - Intergenic
1156881625 18:42087247-42087269 GCCCATGATGTGTCTCCGAGTGG + Exonic
1156990021 18:43398370-43398392 GACCCTGGGGTGTGTCTGTGAGG - Intergenic
1157460100 18:47883793-47883815 GACCATGATATATCTAAGTGTGG + Intronic
1158432963 18:57407494-57407516 GACTATGATTTGTCTTAGTGTGG - Intergenic
1160302601 18:77698758-77698780 GACTCTGATGCATCTCAGTGTGG - Intergenic
1163766336 19:19165438-19165460 GTCTCTGAGGTGTCTCAGGGAGG + Intronic
1165435712 19:35793580-35793602 CACCCAGCTGTGACTCAGTGTGG + Intergenic
1166461129 19:42989431-42989453 GACCCTGATGTTTATCCGTAGGG + Intronic
1166478420 19:43149415-43149437 GACCCTGATGTTTATCCGTAGGG + Intronic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
927121104 2:19964213-19964235 TACAATGATGTGTCTCAATGTGG + Intronic
927256469 2:21044307-21044329 GCCCTTCCTGTGTCTCAGTGGGG + Intergenic
927856438 2:26530520-26530542 GAAGCTGCTGTGACTCAGTGAGG - Intronic
928103155 2:28451174-28451196 GACCTTGAAGTGTCCCAGTTTGG - Intergenic
931685953 2:64793433-64793455 GAGCTTGCTGTGCCTCAGTGGGG - Intergenic
931836178 2:66100296-66100318 GACCCTCATGAGGCTCACTGTGG - Intergenic
932858021 2:75258970-75258992 CACTCTGATATGTCTGAGTGTGG + Intergenic
932979337 2:76645120-76645142 GATCATAATGTGTCTCAATGTGG - Intergenic
933196890 2:79400834-79400856 GACTGTAATGTGTCTCAGTGTGG - Intronic
933540929 2:83641784-83641806 GATTATAATGTGTCTCAGTGTGG + Intergenic
934571330 2:95374936-95374958 AGCCCTGCTGTGTCCCAGTGTGG + Intronic
934704414 2:96466727-96466749 AACCTTTATTTGTCTCAGTGTGG + Intergenic
935061346 2:99610740-99610762 GACTCTGATGAGTCTGGGTGGGG + Intronic
935390665 2:102549498-102549520 GACTCTGATGTGTCTAGGTGTGG - Intergenic
936406091 2:112204498-112204520 GACCATGATGGGTCTAAGTGTGG - Intergenic
937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG + Intergenic
937263014 2:120598381-120598403 GACCCTGGGGTGACTGAGTGGGG + Intergenic
938846333 2:135213275-135213297 GAGCCTGATGTTTCTAAGTCTGG + Intronic
939014283 2:136884281-136884303 GACCCTGAACTGTATCAGTTGGG + Intronic
939037902 2:137155197-137155219 GACCATGAAGAGTCTCTGTGGGG + Intronic
945198899 2:207262318-207262340 GTCCCTGACGTGGCCCAGTGTGG + Intergenic
946648310 2:221864258-221864280 GATTATAATGTGTCTCAGTGTGG + Intergenic
1169561559 20:6806377-6806399 GACTATGATGTGTCTAGGTGTGG - Intergenic
1170738385 20:19030530-19030552 GATTTTAATGTGTCTCAGTGTGG + Intergenic
1179497670 21:41784028-41784050 GCCCCTGATGTAGCTGAGTGTGG - Intergenic
1180594647 22:16965231-16965253 GACCCTGTTGTTTCTCAGGTTGG + Exonic
1181612261 22:24024474-24024496 GACTATAATGTGTCTCAATGTGG + Intronic
1181882030 22:25988826-25988848 GACCCTCAGTTGTCTCACTGGGG - Intronic
1182526842 22:30925873-30925895 CACCTTGATGGGGCTCAGTGGGG + Intronic
1183274211 22:36881981-36882003 GACTATGATGTGTTTAAGTGTGG - Intergenic
1183668710 22:39259593-39259615 CACCCTGATGTCTCTCTTTGAGG - Intergenic
1184658213 22:45952694-45952716 GACCCTGATGGGACTTAGTGTGG + Intronic
951346248 3:21549629-21549651 GAACCTGATGAGTTTCAGTTGGG - Intronic
951480865 3:23160732-23160754 GAGCATGATGTGTTTCAGGGTGG + Intergenic
955509212 3:59662669-59662691 GACCCTGATTTTTCTCTTTGGGG + Intergenic
956036161 3:65094548-65094570 CACCCTGTTGTGTCTCCCTGGGG - Intergenic
956984708 3:74685317-74685339 GTCCAAAATGTGTCTCAGTGGGG - Intergenic
957281446 3:78155436-78155458 CACCCTGATGTGTCCCAGAAAGG - Intergenic
957552666 3:81727098-81727120 GACATTGAACTGTCTCAGTGTGG - Intronic
957608308 3:82432999-82433021 GATTATAATGTGTCTCAGTGTGG - Intergenic
958541347 3:95478273-95478295 GACCCTGGCGTGTCTCTGTGTGG + Intergenic
962190190 3:133302227-133302249 TACACTGATGTGTCACAGTTTGG - Intronic
962535209 3:136323054-136323076 GACTATAATATGTCTCAGTGTGG + Intronic
963908111 3:150790990-150791012 GAGCCAGATGTGCTTCAGTGAGG + Intergenic
964574905 3:158155076-158155098 GACCCTTATGTGTGACTGTGAGG - Intronic
968543462 4:1181071-1181093 GATAATGATGTGTGTCAGTGCGG - Intronic
968562395 4:1290920-1290942 GGCCCTGATGTCTCCCAGTAAGG - Intronic
969545924 4:7827718-7827740 GACTGCGATGTGTCTCAGTGCGG - Intronic
969692732 4:8713019-8713041 GACCAGGATTTGTATCAGTGTGG - Intergenic
971013825 4:22466807-22466829 GAACCTGTGGTCTCTCAGTGAGG - Intronic
971064155 4:23008668-23008690 AAATCTGATGTGCCTCAGTGAGG - Intergenic
972520944 4:39856015-39856037 GACCCTGATGTGTCTCAGTGTGG - Intronic
973272660 4:48277537-48277559 GACTATGATGTGTCTCAGTGTGG - Intergenic
974664080 4:64935635-64935657 GGCTCTGATGGGTCTCAGTGTGG - Intergenic
980685353 4:136220182-136220204 TAAACTGATGTGTGTCAGTGGGG + Intergenic
981002368 4:139840152-139840174 GACCATGTAGTGTCTTAGTGTGG - Intronic
982307277 4:153945828-153945850 GACTCTGATGTGTCTCAATGTGG + Intergenic
986539569 5:8829332-8829354 GACCCTGAAGTGTTTCAGAAAGG - Intergenic
986640165 5:9864201-9864223 GGCCCTGCTGTGCCTGAGTGTGG + Intergenic
987237614 5:15958719-15958741 GTCCCTGAGCTGACTCAGTGTGG - Intergenic
987663919 5:20911110-20911132 GAACCAGAAGTGTCTCAGTAGGG + Intergenic
988758770 5:34291081-34291103 GAACCAGAAGTGTCTCAGTAGGG - Intergenic
992987431 5:82247099-82247121 GACTATGATGTGTCTAGGTGTGG + Intronic
1001095012 5:168769237-168769259 GACCCTGATCTATCACAGAGAGG - Intronic
1001734104 5:173984665-173984687 GACAGTGATGTGTTTCTGTGAGG + Intronic
1002876568 6:1215840-1215862 GACCCTGCTGTCTCCCAGAGGGG - Intergenic
1003295960 6:4828576-4828598 GATTATGATGTGTCTCAGTGTGG + Intronic
1003537462 6:6988090-6988112 CTCCCAGAAGTGTCTCAGTGGGG - Intergenic
1003557804 6:7156515-7156537 AACCCAGATGTGGCTCAGTGCGG - Intronic
1004040720 6:11972457-11972479 GACCGTGATGAGTAGCAGTGTGG - Intergenic
1005836530 6:29713677-29713699 GCCAATGATGTGCCTCAGTGGGG + Intergenic
1005857365 6:29872744-29872766 GCCCATGATGTGCCCCAGTGGGG + Intergenic
1007810161 6:44480001-44480023 GAGCCTGGTGTGTCTCATTCTGG + Intergenic
1010408552 6:75534229-75534251 GACTATGATGTGTCTAAGTGTGG - Intergenic
1011173934 6:84539572-84539594 GACACTGAGGTGTGTCACTGAGG - Intergenic
1011665685 6:89630577-89630599 GACCTTGACGTTTCTCAGTCGGG - Exonic
1012057161 6:94427688-94427710 GATTCTGATGTGTCTCAGTATGG + Intergenic
1012262089 6:97099465-97099487 GACATTGATGGTTCTCAGTGAGG + Intronic
1013491136 6:110646981-110647003 GACCCTCCTCTGTCTCTGTGGGG - Intronic
1014360887 6:120471979-120472001 GAGCCTGGTGGGCCTCAGTGAGG + Intergenic
1017796928 6:157853401-157853423 GACTATGATGTGTCTTTGTGTGG + Intronic
1019084275 6:169459629-169459651 GATGATGATGTGTCTCAGTGTGG - Intronic
1020146171 7:5645190-5645212 GACTCTGATGTGTCGTGGTGTGG + Intronic
1020852256 7:13369345-13369367 GACCCAGCTAAGTCTCAGTGTGG - Intergenic
1024802784 7:53100296-53100318 CTCCCTGATGTGTCACAGTCTGG + Intergenic
1026453008 7:70545743-70545765 GACCCTGAGATGTATCAGTAGGG - Intronic
1028105338 7:86870000-86870022 GATTATAATGTGTCTCAGTGTGG - Intergenic
1028767458 7:94575938-94575960 GATCATGATGTGTCTAAGTGTGG + Intergenic
1029500386 7:100925471-100925493 GAGCCTGATGGGTGTCAGTCAGG - Intergenic
1030084550 7:105805407-105805429 GAACCTGGGGTGACTCAGTGTGG + Intronic
1030255443 7:107505489-107505511 CACCCTGAAGTGTTTCAGAGAGG + Intronic
1031113804 7:117645312-117645334 GTCCTTGATCTGTCACAGTGAGG + Intronic
1032928349 7:136636357-136636379 GCCACTGATGTCTCTCAGTGAGG + Intergenic
1033190705 7:139276338-139276360 GGCCATTATGTGTCACAGTGTGG - Intronic
1033612010 7:142972234-142972256 AACTATGATGCGTCTCAGTGTGG - Intergenic
1033774658 7:144594609-144594631 GACAGTGATGTGTCTTGGTGTGG - Intronic
1034208155 7:149336644-149336666 GATTATAATGTGTCTCAGTGTGG - Intergenic
1034962248 7:155370196-155370218 GCCCCTTCTGTGTCTGAGTGTGG - Intergenic
1036067906 8:5404691-5404713 GACTATGATGTGTTTCATTGTGG + Intergenic
1036493306 8:9247574-9247596 GAACCTCATGTGTCCCTGTGGGG - Intergenic
1038818290 8:30929128-30929150 GATTATGATGTGTCTCAGTGTGG + Intergenic
1039349775 8:36750646-36750668 GATGATGATGTGTCTCACTGTGG + Intergenic
1040656159 8:49511372-49511394 GACTATAATGTATCTCAGTGAGG + Intergenic
1041683743 8:60622777-60622799 CACCCTAATGTGCCTCAGTCTGG + Exonic
1041818649 8:62003452-62003474 CAGCCTGATATCTCTCAGTGGGG - Intergenic
1042148386 8:65756219-65756241 GACTATAGTGTGTCTCAGTGTGG + Intronic
1044914079 8:97093591-97093613 GCCACTTATGTGTCACAGTGGGG - Intronic
1045270450 8:100656909-100656931 GACCCTGCTCTGTCCCAGTCTGG + Intronic
1048111887 8:131476614-131476636 GACCCTGGGGTGCCTCTGTGTGG + Intergenic
1048127560 8:131653794-131653816 GATTATGATGTGTCTAAGTGTGG - Intergenic
1048817245 8:138345234-138345256 GGCCCTGCTGTGTCACAGTGAGG + Intronic
1049648702 8:143752422-143752444 GACTATAATGTGTCTCAGTGTGG + Intergenic
1049869874 8:144966208-144966230 GACCCTCAGGTTCCTCAGTGAGG + Intergenic
1050185846 9:2972737-2972759 GATTATAATGTGTCTCAGTGTGG - Intergenic
1050186047 9:2975113-2975135 GATTATAATGTGTCTCAGTGTGG - Intergenic
1050441473 9:5668380-5668402 GATTCTAGTGTGTCTCAGTGTGG + Intronic
1050621948 9:7463042-7463064 GAACCTGCTGTTACTCAGTGTGG - Intergenic
1051254377 9:15197677-15197699 GACTATGATGTGCCTAAGTGTGG - Intronic
1051553798 9:18359920-18359942 GACACTGATGAGGCTCAGAGTGG - Intergenic
1055329315 9:75166698-75166720 GATCATGATGTGTCTTGGTGTGG + Intergenic
1055799609 9:80020721-80020743 AACCCTGGTGTTTCTTAGTGTGG + Intergenic
1056331855 9:85527902-85527924 GATCCTGCTGTGTGTCAGTCAGG - Intergenic
1056970835 9:91200866-91200888 GAGCATAATATGTCTCAGTGCGG - Intergenic
1058641473 9:107089840-107089862 GACTCTGATATGTCTTAGTGTGG - Intergenic
1060882358 9:127126331-127126353 GACCATGATGTGACTAAGTGTGG + Intronic
1062126381 9:134865174-134865196 GTCCCTGATGTAGCCCAGTGAGG + Intergenic
1062560190 9:137138210-137138232 GACCCTGTTTTGTCCCATTGGGG + Intergenic
1187050465 X:15690954-15690976 GACCTTGAGGTGTCTCACTTAGG + Intronic
1189453130 X:41158283-41158305 GACTATAATGTGTCTCAGTCTGG - Intronic
1190051914 X:47156860-47156882 GAGCTTGCTGTGCCTCAGTGGGG + Intronic
1190121598 X:47664473-47664495 GACTCTGATGTGCCTCAGCATGG + Intergenic
1191699874 X:64030181-64030203 GATTATAATGTGTCTCAGTGTGG + Intergenic
1193288730 X:79745244-79745266 GAGAATAATGTGTCTCAGTGTGG + Intergenic
1193570767 X:83139261-83139283 GACAATAATGTGTCTCAGTATGG - Intergenic
1194774889 X:97950195-97950217 GACTATGATGTGTCTAAATGTGG - Intergenic
1195297418 X:103492749-103492771 TACCTTGATGAGTGTCAGTGTGG - Intergenic
1196305207 X:114094660-114094682 GACTATGATGTGTCTATGTGTGG + Intergenic
1196492712 X:116287381-116287403 GACTATGATGTGCCTGAGTGTGG + Intergenic
1198220536 X:134596962-134596984 GACTATGATATGTCTTAGTGTGG + Intronic