ID: 972527664 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:39931627-39931649 |
Sequence | TCTCTTGGATCTTGCACCAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 136 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 126} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972527664_972527668 | -8 | Left | 972527664 | 4:39931627-39931649 | CCCCTGGTGCAAGATCCAAGAGA | 0: 1 1: 0 2: 0 3: 9 4: 126 |
||
Right | 972527668 | 4:39931642-39931664 | CCAAGAGAGCAAATATGAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972527664 | Original CRISPR | TCTCTTGGATCTTGCACCAG GGG (reversed) | Intronic | ||