ID: 972527664

View in Genome Browser
Species Human (GRCh38)
Location 4:39931627-39931649
Sequence TCTCTTGGATCTTGCACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972527664_972527668 -8 Left 972527664 4:39931627-39931649 CCCCTGGTGCAAGATCCAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 972527668 4:39931642-39931664 CCAAGAGAGCAAATATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972527664 Original CRISPR TCTCTTGGATCTTGCACCAG GGG (reversed) Intronic