ID: 972527668

View in Genome Browser
Species Human (GRCh38)
Location 4:39931642-39931664
Sequence CCAAGAGAGCAAATATGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972527660_972527668 30 Left 972527660 4:39931589-39931611 CCTTTCTAGACAGCTCAAGTGAA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 972527668 4:39931642-39931664 CCAAGAGAGCAAATATGAAGTGG No data
972527666_972527668 -10 Left 972527666 4:39931629-39931651 CCTGGTGCAAGATCCAAGAGAGC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 972527668 4:39931642-39931664 CCAAGAGAGCAAATATGAAGTGG No data
972527664_972527668 -8 Left 972527664 4:39931627-39931649 CCCCTGGTGCAAGATCCAAGAGA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 972527668 4:39931642-39931664 CCAAGAGAGCAAATATGAAGTGG No data
972527665_972527668 -9 Left 972527665 4:39931628-39931650 CCCTGGTGCAAGATCCAAGAGAG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 972527668 4:39931642-39931664 CCAAGAGAGCAAATATGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972527668 Original CRISPR CCAAGAGAGCAAATATGAAG TGG Intronic