ID: 972536011

View in Genome Browser
Species Human (GRCh38)
Location 4:40000466-40000488
Sequence CTGTAATCCCAGCTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972536000_972536011 27 Left 972536000 4:40000416-40000438 CCTGGCCAACATGGTGAAACCCC 0: 64910
1: 151465
2: 197443
3: 160987
4: 104258
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data
972536004_972536011 7 Left 972536004 4:40000436-40000458 CCCGTCTTAACCAGGTGTGTTGG No data
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data
972536006_972536011 6 Left 972536006 4:40000437-40000459 CCGTCTTAACCAGGTGTGTTGGA No data
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data
972536001_972536011 22 Left 972536001 4:40000421-40000443 CCAACATGGTGAAACCCCGTCTT 0: 957
1: 39296
2: 131766
3: 145451
4: 97904
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data
972536003_972536011 8 Left 972536003 4:40000435-40000457 CCCCGTCTTAACCAGGTGTGTTG No data
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data
972536007_972536011 -3 Left 972536007 4:40000446-40000468 CCAGGTGTGTTGGAGCGTGCCTG No data
Right 972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972536011 Original CRISPR CTGTAATCCCAGCTGAGGCT GGG Intergenic
No off target data available for this crispr