ID: 972537443

View in Genome Browser
Species Human (GRCh38)
Location 4:40011286-40011308
Sequence CTCCTCAGTGATGCCAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972537443_972537445 -1 Left 972537443 4:40011286-40011308 CCTCAGTTGGCATCACTGAGGAG No data
Right 972537445 4:40011308-40011330 GGTACTTTTCTCTAAACTCTTGG No data
972537443_972537448 7 Left 972537443 4:40011286-40011308 CCTCAGTTGGCATCACTGAGGAG No data
Right 972537448 4:40011316-40011338 TCTCTAAACTCTTGGGAGGTAGG No data
972537443_972537449 14 Left 972537443 4:40011286-40011308 CCTCAGTTGGCATCACTGAGGAG No data
Right 972537449 4:40011323-40011345 ACTCTTGGGAGGTAGGCACATGG No data
972537443_972537447 3 Left 972537443 4:40011286-40011308 CCTCAGTTGGCATCACTGAGGAG No data
Right 972537447 4:40011312-40011334 CTTTTCTCTAAACTCTTGGGAGG No data
972537443_972537446 0 Left 972537443 4:40011286-40011308 CCTCAGTTGGCATCACTGAGGAG No data
Right 972537446 4:40011309-40011331 GTACTTTTCTCTAAACTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972537443 Original CRISPR CTCCTCAGTGATGCCAACTG AGG (reversed) Intergenic
No off target data available for this crispr