ID: 972538517

View in Genome Browser
Species Human (GRCh38)
Location 4:40019294-40019316
Sequence GAAAAATCTGGCTGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972538513_972538517 -5 Left 972538513 4:40019276-40019298 CCAGCTAATCATGAAAGAGAAAA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538509_972538517 12 Left 972538509 4:40019259-40019281 CCCAGTGGTTCCAAAGCCCAGCT No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538510_972538517 11 Left 972538510 4:40019260-40019282 CCAGTGGTTCCAAAGCCCAGCTA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538511_972538517 2 Left 972538511 4:40019269-40019291 CCAAAGCCCAGCTAATCATGAAA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538512_972538517 -4 Left 972538512 4:40019275-40019297 CCCAGCTAATCATGAAAGAGAAA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538507_972538517 21 Left 972538507 4:40019250-40019272 CCCACTAAACCCAGTGGTTCCAA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data
972538508_972538517 20 Left 972538508 4:40019251-40019273 CCACTAAACCCAGTGGTTCCAAA No data
Right 972538517 4:40019294-40019316 GAAAAATCTGGCTGGCACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972538517 Original CRISPR GAAAAATCTGGCTGGCACGG TGG Intergenic