ID: 972543205

View in Genome Browser
Species Human (GRCh38)
Location 4:40056920-40056942
Sequence GCGGGAGAGCGCAGTGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972543195_972543205 14 Left 972543195 4:40056883-40056905 CCCCCGCGGCCGCAGCTGCTTGC 0: 1
1: 0
2: 2
3: 55
4: 636
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206
972543197_972543205 12 Left 972543197 4:40056885-40056907 CCCGCGGCCGCAGCTGCTTGCTA 0: 1
1: 0
2: 0
3: 6
4: 125
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206
972543198_972543205 11 Left 972543198 4:40056886-40056908 CCGCGGCCGCAGCTGCTTGCTAG 0: 1
1: 0
2: 1
3: 6
4: 94
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206
972543194_972543205 22 Left 972543194 4:40056875-40056897 CCGTGTCTCCCCCGCGGCCGCAG 0: 1
1: 0
2: 1
3: 7
4: 177
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206
972543199_972543205 5 Left 972543199 4:40056892-40056914 CCGCAGCTGCTTGCTAGCCTTGC 0: 1
1: 0
2: 1
3: 12
4: 192
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206
972543196_972543205 13 Left 972543196 4:40056884-40056906 CCCCGCGGCCGCAGCTGCTTGCT 0: 1
1: 0
2: 0
3: 10
4: 186
Right 972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG 0: 1
1: 0
2: 1
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972543205 Original CRISPR GCGGGAGAGCGCAGTGGCGC CGG Exonic
901230612 1:7639973-7639995 GAGGGAGAGGGCAGTGGCTGTGG + Intronic
901686301 1:10945498-10945520 GCGGGAGAGTGCAGCGGGGATGG - Intergenic
901836226 1:11925877-11925899 GCGGGAGCCCGCCGTGGCGCCGG - Exonic
902467243 1:16625936-16625958 GCAGGAGGCCACAGTGGCGCCGG - Intergenic
902507342 1:16946808-16946830 GCAGGAGGCCACAGTGGCGCGGG + Exonic
902586108 1:17439302-17439324 AGGGGAGAGCGCAGGGACGCCGG - Intronic
904128814 1:28260497-28260519 GAGGGAGAGCGCAGGGGCTCTGG + Intronic
904170978 1:28592155-28592177 GCGGGGGAGCGGTGTGGAGCGGG + Intronic
904671572 1:32170000-32170022 GAGGGCAAGCGCAGTGGCTCAGG + Exonic
906719972 1:47997390-47997412 GCGGGAGAGCGGCGCGGAGCCGG + Intergenic
909084616 1:71155973-71155995 GAGTGAGAGCACAGTGGCGGTGG - Intergenic
915254611 1:154616889-154616911 GCTGGAGAGGGCAGTGGGCCAGG - Intronic
915310984 1:155005691-155005713 GCGGGAGAGAACAGTGGGGGAGG + Intronic
915333170 1:155126128-155126150 GAGGGAGAGGGGGGTGGCGCTGG + Intergenic
915577047 1:156786342-156786364 GTGGAAGAGGGCAGTGGAGCTGG + Intronic
921207115 1:212858418-212858440 GCGGGGGAGCGAGGTGGCGCCGG + Exonic
922695336 1:227728484-227728506 GCGGGAGAGCCAGGTGGGGCGGG - Intergenic
924516320 1:244769012-244769034 GAGGGAGAGCGCAGTGACTGGGG - Intergenic
1065551679 10:26873826-26873848 GGGGCAGAGCGCGGTGGCTCAGG - Intergenic
1066064705 10:31753583-31753605 GCGTGAGAGCGCTGTGAAGCAGG - Intergenic
1066780715 10:38942551-38942573 GTGGGAGAAAGCAGTGGCGGTGG - Intergenic
1068538642 10:58267951-58267973 GCGGGAGGGGGCGGGGGCGCAGG - Intergenic
1070675384 10:78408296-78408318 GCGGCAGAGCGCAGGAGCCCAGG - Intergenic
1074884475 10:117683773-117683795 GGGCGAGAGCCCAGTGGCGGTGG - Intergenic
1075626971 10:123970551-123970573 GCGGAACCGCGCAGTGGAGCTGG - Intergenic
1078740365 11:14060372-14060394 GCAGGAGAGCCCAGTGGAGAAGG + Intronic
1079482146 11:20892628-20892650 GCGGCCGGGCGCAGTGGCTCAGG + Intronic
1080351652 11:31392114-31392136 GGGGGAGAGGGCAGTGGAGATGG + Intronic
1080901983 11:36503376-36503398 GCGGGAGAACCCAGAGGCGGGGG - Intronic
1083921627 11:65784175-65784197 GCGGGAGACAGCAGTGTGGCTGG + Intergenic
1086945306 11:92838797-92838819 GCTGGACAGCTCAGTGGCCCTGG - Intronic
1088147887 11:106705577-106705599 GAGGCAGGGCGCAGTGGCTCAGG + Intronic
1089065685 11:115660263-115660285 TCGGGAGAGCGCCGTCGCTCCGG - Intergenic
1089596539 11:119584467-119584489 GCGGCGGAGCTCAGGGGCGCAGG + Intergenic
1090889844 11:130914297-130914319 GCCCGAGAGCACAGTGGCACTGG - Exonic
1091207701 11:133832886-133832908 ACGGGGGAGGGCAGTGGCTCCGG + Intergenic
1092477142 12:8828951-8828973 GCGGGAGAGCACAGTGACTGTGG - Intronic
1094487601 12:30937437-30937459 GCGGCAGGGGGCAGTGGGGCAGG + Intronic
1094682626 12:32679541-32679563 GCGGGAGTGGGCGCTGGCGCGGG - Intronic
1096682800 12:53268176-53268198 GCGGGAGCGCGCAGCGCGGCGGG + Intergenic
1096814919 12:54195998-54196020 GCGGGCGGGGGCAGTGGGGCCGG - Intergenic
1097086043 12:56469166-56469188 CCGGGAGTGGGCAGTGGTGCTGG + Exonic
1097569095 12:61308722-61308744 GTGGGAGAGCGCAGTGACTGAGG - Intergenic
1099757786 12:86876892-86876914 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1099890223 12:88580682-88580704 GCGGGAGACCGCGAAGGCGCGGG + Intronic
1102676862 12:114665213-114665235 GCGGGAAACCGAAGTGGCGCGGG + Intergenic
1103377664 12:120469391-120469413 GGAGGAGAGGGCAGGGGCGCGGG + Intronic
1104426648 12:128683343-128683365 CCGGGAGAGAGCAGTGTCACAGG - Intronic
1104940332 12:132392095-132392117 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940359 12:132392152-132392174 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940385 12:132392209-132392231 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940412 12:132392266-132392288 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1104940466 12:132392380-132392402 GGGGGAGAGCGGGGTGGCGGAGG - Intergenic
1105847589 13:24307314-24307336 GCGGAAGGGAGCAGTGGGGCGGG + Intronic
1107939706 13:45372796-45372818 GCGGGAAAGCGGAGGGGCACGGG - Intergenic
1112086490 13:96037476-96037498 GCGGCCAAGCGCAGTGGCTCAGG - Intronic
1113906725 13:113822720-113822742 GCGGGAGGGCTCTGTGGCCCCGG + Intronic
1113933604 13:113981608-113981630 GCGGGAGATTGCAGTGGGGGTGG - Intronic
1114452678 14:22837343-22837365 GCGGGAGAGCGCTGGAGAGCTGG - Intronic
1114458572 14:22872592-22872614 GCGGGAGAGGGCTGCGGCGTGGG - Intronic
1115691474 14:35848611-35848633 GTGGGAGTGGGCAGTGGGGCAGG - Intronic
1116344932 14:43780945-43780967 GTGGGAGATCACAGTGGCTCAGG + Intergenic
1118313089 14:64707062-64707084 GCGGGACAGAGCAGTGGCCTGGG - Intronic
1121183575 14:91947700-91947722 GCGGGCGCGCGCAGGGGTGCGGG + Exonic
1122268627 14:100558365-100558387 GCCGGAGAGCGCAGTGAGGGTGG - Intronic
1122740204 14:103867795-103867817 TGGGGAGAGCTCAGTGGAGCTGG + Intergenic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124372757 15:29112784-29112806 GCAGGAGAGCGCAGTGGCCATGG - Intronic
1125658276 15:41376111-41376133 GCGGCCGGGCGCAGTGGCTCTGG + Intronic
1126113215 15:45187540-45187562 GTGGGGGAGAGCCGTGGCGCGGG + Intronic
1127581973 15:60346892-60346914 ACTGGAGAGAGCAGTGGGGCAGG - Intergenic
1132734604 16:1379310-1379332 GCAGGAGAGCGGAGCGGAGCGGG - Intronic
1133033508 16:3022569-3022591 GGTGGAGAGGGCAGAGGCGCGGG - Intergenic
1134107366 16:11494116-11494138 GGGGGAGGGGGCAGTGGCGTGGG + Intronic
1134531860 16:14989800-14989822 GCGGGAGCCCGCCGTGGCGCCGG - Intronic
1135424317 16:22324766-22324788 TGGGGAGAGCGCAGTTGGGCTGG + Intronic
1135828405 16:25751144-25751166 GCAGGAGAGAGCAGTTGCGCAGG + Intronic
1136071592 16:27790957-27790979 GAAGGAGGGGGCAGTGGCGCAGG - Exonic
1136135791 16:28256214-28256236 GGGGGAGGCCGCAGTGGCCCAGG - Intergenic
1136779025 16:32885649-32885671 GCGGGAGAGCGGCGGGGTGCGGG + Intergenic
1136891593 16:33975869-33975891 GCGGGAGAGCGGCGGGGTGCGGG - Intergenic
1137441993 16:48505814-48505836 GCGGGAGAGGGCAGAAGGGCAGG + Intergenic
1142189774 16:88712521-88712543 GCGGGAGACGGCAGTGAGGCTGG - Intronic
1142210113 16:88804693-88804715 GCGGGAGGGCTGAGTGGTGCCGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143166372 17:4899179-4899201 ACGGGTGAGCACAGTGGCCCTGG - Exonic
1144021076 17:11240777-11240799 GCGGGAGCGCGCTGCGGGGCCGG + Intergenic
1146398696 17:32487404-32487426 GCGGAGGGGCGCAGGGGCGCAGG + Intronic
1147312634 17:39604409-39604431 GCGGGGGAGGGCAGTGGCACTGG + Intronic
1147743154 17:42680008-42680030 GGGGGCGAGCGCCGTGGCGCAGG - Exonic
1149712672 17:58756706-58756728 GCGGGAGGGCGCCGGGGCTCAGG - Intronic
1152117519 17:78397714-78397736 GCGGCCGGGCGCAGTGGCTCAGG - Intronic
1152299098 17:79485069-79485091 GTGGGAGAGAGCAGCGGGGCAGG - Intronic
1152362518 17:79839258-79839280 GCCGGAGCGCGCCGGGGCGCTGG + Exonic
1152506712 17:80754214-80754236 GCGGGAGAGCCCAGTTGAGTGGG - Intronic
1154464536 18:14631161-14631183 GCCCGAGAGCACAGTGGCACCGG - Intergenic
1155053517 18:22167207-22167229 GCGGGAGGGCGCGCTGGCCCCGG - Intergenic
1155826262 18:30446966-30446988 GGGAGAGAGCGCAGTGGCAGTGG - Intergenic
1157794475 18:50560835-50560857 GCCGGAGAGGGCAGCGGCTCGGG + Intronic
1159142534 18:64414891-64414913 TGGGGAGAGCTCAGTGGAGCTGG + Intergenic
1159489051 18:69105999-69106021 GCAGTGGAGTGCAGTGGCGCTGG + Intergenic
1159489076 18:69106223-69106245 GCGCTGGAGTGCAGTGGCGCTGG + Intergenic
1160044418 18:75373358-75373380 GCGGGAGTGTGCAGTGGATCAGG - Intergenic
1160453691 18:78980953-78980975 GGGGGTGAGCGCAGCGGCGGCGG + Intronic
1160698784 19:496731-496753 GCAGGAGAGAGGAGGGGCGCAGG + Intronic
1160698898 19:497059-497081 GCAGGAGAGAGGAGGGGCGCAGG + Intronic
1160726796 19:620982-621004 GGGGGAGGGCGCGGGGGCGCCGG + Intronic
1160967555 19:1753322-1753344 GCGGGCGGGCGCAGTGGCCAGGG + Exonic
1161454138 19:4361803-4361825 GCGGGAGCGGGCTGTGGGGCTGG + Intronic
1162766858 19:12924916-12924938 GCGGTAGAGCGCACGGGCGCTGG + Exonic
1163654810 19:18539516-18539538 GCGGGACAGGGCAGGGGCGAGGG - Intronic
1163772245 19:19198136-19198158 GCGAGAGAGCGCCCTGTCGCTGG + Exonic
1166094208 19:40529503-40529525 GCAGGAGGGCGCAGGGCCGCTGG - Intronic
1166994544 19:46714009-46714031 GCGGGAGAGGGATGTGGCGACGG + Intronic
924985385 2:264864-264886 GCGGGACTGCGCAGGCGCGCGGG + Exonic
926315617 2:11707604-11707626 GCGGGAGAGAGCAGCGTGGCTGG + Intronic
926696909 2:15776737-15776759 GCGGGAGAGGGCAGGGGCTCAGG - Intergenic
926731407 2:16038549-16038571 GCTGGAGTGCTCAGTGGCACTGG - Intergenic
928303690 2:30147853-30147875 GCGGCAGAGCGCGGCGGCGGCGG - Intronic
928442253 2:31302296-31302318 GTGGGAGAGCGCTGTGTAGCTGG + Intergenic
929604637 2:43226456-43226478 GAGGGCGAGTGCAGCGGCGCGGG + Exonic
931467686 2:62505885-62505907 GCGGGAGAGCGCCTTGGAGGAGG - Intronic
931669556 2:64634956-64634978 GCGGGAGATGGCTGTGGAGCTGG - Exonic
948200959 2:236129389-236129411 GCAGGAGAGAGAAGGGGCGCAGG + Exonic
948936491 2:241168556-241168578 GCGAGGGAGCTCAGTGGGGCGGG - Intronic
948945674 2:241217921-241217943 GCGGGGGCGCGCAGGGGCGGGGG + Intronic
1173807467 20:45935091-45935113 GCGGGAGCGCGCGGCGGGGCGGG + Intronic
1175699424 20:61126301-61126323 GAGGCCGAGCGCAGTGGCTCAGG + Intergenic
1175964911 20:62655571-62655593 GCTGGTGAGGGCAGTGGGGCAGG + Intronic
1176234546 20:64048384-64048406 GCTGGAGAGCGCCGAGCCGCTGG - Exonic
1176235095 20:64050256-64050278 GAGGGAGAGAGCAGAGGCCCTGG + Intronic
1176288637 21:5032922-5032944 GCAGCAGGACGCAGTGGCGCAGG + Intronic
1176428576 21:6563067-6563089 GCTGGAGAGCAGAGTGGGGCTGG + Intergenic
1179704066 21:43171383-43171405 GCTGGAGAGCAGAGTGGGGCTGG + Intronic
1179729695 21:43360831-43360853 GTGGGAGAGCGCAGTCACCCAGG - Intergenic
1179868547 21:44230553-44230575 GCAGCAGGACGCAGTGGCGCAGG - Intronic
1180137663 21:45871673-45871695 CGGGGAGAGGGCAGTGGCCCTGG - Intronic
1182222980 22:28773102-28773124 GCGGGCGCGGGCAGGGGCGCGGG + Intronic
1182541387 22:31044581-31044603 GCGGGAGGCCGAAGTGGAGCTGG + Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183645625 22:39124361-39124383 GCGGGGGAGGGCAGTGAAGCTGG + Intronic
1184099897 22:42336512-42336534 GAGGGAGATGGCAGTGGGGCTGG - Intronic
1184561893 22:45268504-45268526 GCGGGTGAGGGGAGTGGGGCGGG - Intergenic
1184669783 22:46006637-46006659 GCGGGAGGCAGCAGTGGAGCTGG - Intergenic
1185052065 22:48559228-48559250 GCGGGGCAGCCCAGTGGCCCAGG - Intronic
1185420268 22:50731031-50731053 GCGGGCGAGGGCAGCGGCGACGG - Intergenic
949533730 3:4979685-4979707 ACAGGAGCGCGCAGTGGCCCCGG + Exonic
950087662 3:10272009-10272031 GGGGGCGGGCGCAGTGGCTCAGG - Intronic
950487824 3:13283157-13283179 GCGGCGGAGCGCGGCGGCGCGGG - Intergenic
951907813 3:27721639-27721661 GCCGGTGCGGGCAGTGGCGCGGG - Exonic
953661468 3:44894297-44894319 GTGGGAGAGAGCTGTGGCGGGGG - Intronic
961591143 3:127982759-127982781 GAGGGAGAGAGCACTGGAGCTGG - Intronic
963133116 3:141876538-141876560 GCGGGAGGCGGCAGCGGCGCGGG + Intronic
964819670 3:160755904-160755926 GCGGGAGAGTTCAGGGGCGCCGG - Intronic
965757406 3:172040277-172040299 GCGGGAGTGCGAAGTGGGGCTGG + Intronic
968067070 3:195764624-195764646 GCTGGAGAGCGCAGGGGTGTGGG - Intronic
968881016 4:3300241-3300263 GCTGGAGACAGCAGTGCCGCGGG + Intronic
969115381 4:4867626-4867648 GCGGGAGGGCGCTGTGGGGGAGG - Intergenic
972543205 4:40056920-40056942 GCGGGAGAGCGCAGTGGCGCCGG + Exonic
977612896 4:99054801-99054823 GAGGGAGAGAGAAGTGGGGCAGG + Intronic
977803888 4:101273370-101273392 GAGTGATCGCGCAGTGGCGCAGG + Intronic
978094688 4:104761769-104761791 GTGGCCGAGCGCAGTGGCTCAGG + Intergenic
978384689 4:108167904-108167926 GCGGGCGAGCGCGGGGCCGCCGG + Exonic
979785704 4:124712858-124712880 GCGGGAGAGCGCGGTGGGGGAGG - Intergenic
994631704 5:102295820-102295842 GGGGGAGAGGGCAGGTGCGCGGG - Intronic
995224617 5:109689464-109689486 GCTGGAGCGCCAAGTGGCGCTGG + Exonic
995623901 5:114056210-114056232 GCCGGAGAGCTCCGGGGCGCGGG - Intergenic
997647342 5:135490130-135490152 GCAGGAGAGTGCGGTGGCTCGGG + Intergenic
1000463380 5:161548061-161548083 GCGGGAGAACACAGTGCCTCCGG - Exonic
1002091615 5:176809978-176810000 GCGGGAGAGCCCCGGGGCCCTGG - Intergenic
1002186063 5:177455415-177455437 GCGGGAGCGCGTGGTGGTGCGGG - Exonic
1002487782 5:179551098-179551120 GTGGGAGAGCATAGAGGCGCGGG - Intronic
1003857619 6:10292434-10292456 GTGGGATAGTGCAGTGGCTCTGG - Intergenic
1004413246 6:15400871-15400893 GAGGAAGAGCGCAGTGAGGCAGG - Intronic
1006086926 6:31602395-31602417 GAGGCCGAGCGCAGTGGCTCAGG - Intergenic
1007360681 6:41353182-41353204 GCTGGAGAGGGAAGTGGGGCAGG + Intergenic
1009748207 6:67847707-67847729 GAGGGAGAGCGCAGTGACTGGGG + Intergenic
1012170988 6:96016221-96016243 GCGGGAGAGTGCAGGGGGTCGGG + Intronic
1013480791 6:110551041-110551063 CCGGGAGAGGGCAGTGGCGCTGG - Intergenic
1014104227 6:117545070-117545092 GAGAGAGAGGGCAGTGGGGCAGG + Intronic
1014280447 6:119437554-119437576 GAGGCCGAGTGCAGTGGCGCGGG + Intergenic
1015149066 6:130019204-130019226 GTGGGGGAGCGCGGCGGCGCCGG + Intronic
1016134377 6:140520712-140520734 GAGGCAGGGCGCAGTGGCTCAGG - Intergenic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1017313494 6:153002219-153002241 GCGGCAGAGCGCCGTGGCAAAGG + Intronic
1019349931 7:549887-549909 GCGGCGGGGTGCAGTGGCGCGGG + Exonic
1019406324 7:885996-886018 GCGGGGGAGCGCGGTGGCGAGGG + Intronic
1019601611 7:1886522-1886544 GTGGGAGAGCACGGTGGCACGGG + Intronic
1019735199 7:2647019-2647041 GCAGGTGAGCGCGGTGGGGCGGG + Exonic
1022715183 7:32891982-32892004 GCGGGAGGGCGGCGTGGCGAGGG - Intronic
1029042611 7:97593396-97593418 GAGGGAGAGTGCAGTGGCTGTGG - Intergenic
1030659506 7:112205354-112205376 CCGGGTGAGCGCAGTGGGGGCGG - Intronic
1031761898 7:125723776-125723798 CTGGGACAGCGCAGTGGCTCAGG + Intergenic
1032344330 7:131105852-131105874 GCGGGAGGGGGCCGGGGCGCGGG - Intergenic
1034900612 7:154905999-154906021 GGGGGAGAGCACAGTGTCGGAGG - Intergenic
1035017949 7:155782642-155782664 GGGGGAGAGCACAGTGGCTGTGG + Intergenic
1037600698 8:20391502-20391524 GTGGGAGAGGGAAGTGGGGCTGG + Intergenic
1037878657 8:22561928-22561950 GTGGGTGAGCACAGTGGGGCGGG + Exonic
1040587325 8:48756245-48756267 GCCGGAGAGCGCGGGAGCGCCGG + Intergenic
1045737939 8:105318538-105318560 GAGGGGGAGCGCGGGGGCGCAGG - Intronic
1049441711 8:142612629-142612651 CCGGGAGAGGGCGGCGGCGCCGG + Exonic
1049541355 8:143210595-143210617 GCGGTTGAGCCCAGGGGCGCAGG + Intergenic
1049585182 8:143429754-143429776 GCGGGACACGGCGGTGGCGCGGG - Exonic
1049682528 8:143926068-143926090 GCTGGTGAGCACAGTGGGGCCGG - Intronic
1049860790 8:144897216-144897238 GCAGGAGAAGGCAGTGGCCCTGG - Intronic
1054460246 9:65458646-65458668 GCGGGAGAGGGCTGTGAGGCGGG - Intergenic
1057222012 9:93262542-93262564 GCAGGAGAACGCAGCGGGGCAGG + Intronic
1057874441 9:98743253-98743275 GCGGGGGAGGGCTGTGGCCCAGG - Intronic
1058493192 9:105524670-105524692 TCAGGAGAGCGCAGAGGCTCAGG - Intronic
1061133875 9:128722583-128722605 GCCGGAGAGCACAGTGAGGCTGG + Intronic
1061386960 9:130296086-130296108 GTGGGAGGGCTCAGTGGGGCAGG + Intronic
1061908634 9:133711479-133711501 TTGGGAGAGTGCAGGGGCGCAGG + Intronic
1061940604 9:133881821-133881843 GCGGAAGAGTTCAGTGGCCCCGG + Intronic
1062184957 9:135213238-135213260 GCGGGAGAGTGCAGGGACCCAGG - Intergenic
1062332718 9:136051594-136051616 GCGGGCGGCCGCAGAGGCGCCGG + Intronic
1062360559 9:136186013-136186035 GCGGTGGCGGGCAGTGGCGCTGG + Intergenic
1185504198 X:619646-619668 GCGGGTGAGCGCAGGGGTTCTGG - Intergenic
1189473927 X:41334632-41334654 GCGGGAGTGCGCAGCGCGGCGGG + Intronic
1197099677 X:122637408-122637430 GAGGGAGAGCGCAGTGACTGTGG - Intergenic
1199794835 X:151184093-151184115 GAGGCGGGGCGCAGTGGCGCAGG - Intergenic
1200146369 X:153928280-153928302 GCGCGCGAGCCCAGTGCCGCCGG + Intronic
1200345008 X:155439405-155439427 CTGGGGGAGCGCAGTGGCACTGG - Intergenic
1201691708 Y:16774647-16774669 GTGAGAGAGGGCAGTGGAGCTGG + Intergenic