ID: 972543233

View in Genome Browser
Species Human (GRCh38)
Location 4:40057037-40057059
Sequence GCGGCGGGTGGGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2037
Summary {0: 1, 1: 1, 2: 11, 3: 168, 4: 1856}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972543221_972543233 -1 Left 972543221 4:40057015-40057037 CCCGCTCCAGAAGCAGGTAAAGG 0: 1
1: 0
2: 1
3: 16
4: 226
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856
972543225_972543233 -7 Left 972543225 4:40057021-40057043 CCAGAAGCAGGTAAAGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856
972543219_972543233 5 Left 972543219 4:40057009-40057031 CCTCTGCCCGCTCCAGAAGCAGG 0: 1
1: 0
2: 2
3: 22
4: 270
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856
972543218_972543233 6 Left 972543218 4:40057008-40057030 CCCTCTGCCCGCTCCAGAAGCAG 0: 1
1: 0
2: 2
3: 16
4: 313
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856
972543223_972543233 -2 Left 972543223 4:40057016-40057038 CCGCTCCAGAAGCAGGTAAAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856
972543217_972543233 18 Left 972543217 4:40056996-40057018 CCGGCTTCGACGCCCTCTGCCCG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG 0: 1
1: 1
2: 11
3: 168
4: 1856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972543233 Original CRISPR GCGGCGGGTGGGAGGCAGGG AGG Intronic
Too many off-targets to display for this crispr