ID: 972545901

View in Genome Browser
Species Human (GRCh38)
Location 4:40080457-40080479
Sequence CTGTAGTCCCAGACAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 1, 2: 24, 3: 146, 4: 475}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972545901_972545908 26 Left 972545901 4:40080457-40080479 CCTGCCTCTGTCTGGGACTACAG 0: 1
1: 1
2: 24
3: 146
4: 475
Right 972545908 4:40080506-40080528 TTTTGTATTTTAGTAAAGACAGG 0: 148
1: 5040
2: 8018
3: 10506
4: 36524
972545901_972545909 27 Left 972545901 4:40080457-40080479 CCTGCCTCTGTCTGGGACTACAG 0: 1
1: 1
2: 24
3: 146
4: 475
Right 972545909 4:40080507-40080529 TTTGTATTTTAGTAAAGACAGGG 0: 63
1: 2318
2: 5523
3: 10075
4: 25809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972545901 Original CRISPR CTGTAGTCCCAGACAGAGGC AGG (reversed) Intronic
900731253 1:4262292-4262314 CTCAAGTCCCAGAAAGAGGCAGG + Intergenic
901152488 1:7113192-7113214 CAGAAGCCACAGACAGAGGCTGG + Intronic
901384070 1:8895516-8895538 CTGTAATCCCAGACCGAGGTGGG + Intergenic
901792671 1:11662499-11662521 CTGGAGGCCCAGCCACAGGCTGG + Exonic
901932071 1:12602293-12602315 CTGTCTTCCCAGGCAGGGGCTGG - Intronic
902309671 1:15572305-15572327 CTGTAATCCCAGGCCTAGGCGGG - Intronic
902905301 1:19552225-19552247 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
903737485 1:25539357-25539379 CTGTAGTCCCACCTACAGGCTGG - Intergenic
904107939 1:28101517-28101539 CTGTAATCCTAGACTGAGGCAGG + Intergenic
905713882 1:40131633-40131655 CTGTAATCCCAGCTACAGGCTGG - Intergenic
907006895 1:50923300-50923322 CTGTAGTCCTAGCCTGAGGCAGG + Intronic
907078880 1:51603031-51603053 CTGTAGTCCCAGTTATAGGGTGG + Intronic
907794282 1:57699195-57699217 CTGTAATCCCAGACTTAGGGAGG - Intronic
908169892 1:61493924-61493946 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
908520048 1:64932796-64932818 GGGCAGTCCCAGGCAGAGGCAGG - Intronic
908843064 1:68297849-68297871 CTGTAGTCCCAGCCACTGGCAGG - Intergenic
910333484 1:86102729-86102751 CTGTAGTCCAAGAGAGTGGTTGG + Intronic
910570481 1:88696116-88696138 CAGTAGTAACAAACAGAGGCAGG - Intronic
910924438 1:92384078-92384100 CTGTAGTCCCAGCTACAGGGAGG - Intronic
912914948 1:113805333-113805355 CTGTATTCCCAGACCAAGGTGGG - Intronic
913003301 1:114603383-114603405 CTGTAATCCCAGGCCAAGGCGGG - Intronic
913005630 1:114628192-114628214 CTGTAGTCCCAGCTACAAGCTGG + Intronic
913323961 1:117610203-117610225 CTGTAGAACTAGCCAGAGGCAGG - Intronic
914927893 1:151905165-151905187 CTGTTCTCCCAGTCAAAGGCTGG - Intronic
916097104 1:161360988-161361010 CTGTAGTCCCAGCCACTGGCAGG + Intronic
917296210 1:173522103-173522125 CTGTAGTCCCAGCTACAGGCTGG + Intronic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
918856772 1:189765637-189765659 CTGTAGACCCAGGCTGAGACAGG - Intergenic
919908492 1:202095017-202095039 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
920506226 1:206517350-206517372 CTGTAGTCCCAGCTACATGCTGG + Intronic
922418494 1:225443282-225443304 CTGTATTCCCAGATACTGGCTGG - Intergenic
923691623 1:236199095-236199117 CTTTAGTCCTAAACAGATGCTGG + Intronic
924543789 1:245006421-245006443 CTGTAATCACAGGCTGAGGCAGG - Intronic
1062850317 10:737712-737734 CTCCAGACCCAGACAGAGGGAGG + Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1064019098 10:11795024-11795046 CTGTATTCCCAGCTACAGGCTGG - Intergenic
1064019725 10:11799385-11799407 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064146833 10:12832540-12832562 TTCTAGTCTCCGACAGAGGCAGG - Exonic
1064543126 10:16425244-16425266 CTGAAGTCTCAGAGAGAAGCAGG - Intergenic
1064805260 10:19122991-19123013 CTGTAATCCCAGGCATGGGCTGG - Intronic
1065896140 10:30164639-30164661 CTGTAATCCCAGTCCGAGGCAGG - Intergenic
1066349766 10:34626420-34626442 CTGTATTCCCACACAGAGAGGGG - Intronic
1067111327 10:43403138-43403160 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1067277767 10:44850135-44850157 CTGCAGCCCCACACAGAGGTGGG + Intergenic
1067389738 10:45852166-45852188 CTGTAATCCCAGACTGTGGGAGG - Intronic
1067873526 10:49983890-49983912 CTGTAATCCCAGACTGTGGGAGG + Intronic
1068774685 10:60857084-60857106 CTGCAGTCCCAGCCACAGTCTGG - Intergenic
1068957840 10:62836054-62836076 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1069250010 10:66256067-66256089 ATGTTGGCCCAGACAGAGGCAGG + Intronic
1069442563 10:68442035-68442057 CTGTAGTCCCAGGATGAGGTGGG - Intronic
1069460635 10:68591778-68591800 CTGTAGTCCCAGCTACTGGCTGG + Intronic
1069970843 10:72167756-72167778 TTGTAGTCCCAGCCACAGGGAGG - Intronic
1070243543 10:74707904-74707926 CTGTAATCCCAGGCCAAGGCAGG + Intronic
1070758482 10:79008460-79008482 CTGAGGTTCCAGACAGGGGCTGG - Intergenic
1071573550 10:86710824-86710846 CTTTTGCCCGAGACAGAGGCCGG + Intronic
1071697359 10:87890825-87890847 CTTTAGTCCCAGGCTGAGGTGGG - Intronic
1072506671 10:96074731-96074753 CAGTATTCCCAGACACAGGCAGG + Intergenic
1072647113 10:97265375-97265397 CTGTAGTCCCAGCTAGTGGGAGG + Intronic
1072697364 10:97613834-97613856 CTGTAGTGCCATTCAGAGCCTGG - Intronic
1073323359 10:102628778-102628800 CTCCAGCCCCAGACCGAGGCAGG + Intronic
1073355322 10:102849252-102849274 CTGCAATCCCAGGCAGAGGTGGG - Intergenic
1073848130 10:107583148-107583170 CTGTAGTCCCAGCCACTTGCAGG - Intergenic
1073867910 10:107825960-107825982 CTGTAGGCCTGGACAGAGGGTGG + Intergenic
1073931213 10:108578987-108579009 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1075067517 10:119299319-119299341 CTGTAATTCCAGGCTGAGGCAGG + Intronic
1075614483 10:123881504-123881526 CTGTGGTCTCAGCCAGAGTCAGG + Intronic
1075894310 10:125981383-125981405 CTGTAGTCCCGGGCTGAGGTGGG + Intronic
1076039268 10:127229110-127229132 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1076706444 10:132304594-132304616 CTGTATTTCCAGAAAAAGGCTGG + Intronic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1077485092 11:2834937-2834959 CTGGGGTCCCAGATAGGGGCTGG - Intronic
1078122760 11:8527081-8527103 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078182773 11:9026678-9026700 CTGTAATCCCAGGCTGAGGGAGG - Intronic
1078401499 11:11031658-11031680 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1078428362 11:11269065-11269087 CTGTAGTCTCAGACAGGCCCTGG - Intergenic
1080223335 11:29932714-29932736 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1080523713 11:33091834-33091856 CTGTAGTCCCAGATACTGGGAGG - Intronic
1081265500 11:41015876-41015898 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1081678077 11:44982635-44982657 CGGGAGGCCGAGACAGAGGCAGG + Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1083266563 11:61549744-61549766 CTGCAGGACCACACAGAGGCAGG + Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083818201 11:65149738-65149760 CTGTAGTCCCAGACTTTGGGAGG - Intergenic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1083873460 11:65506896-65506918 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1084155588 11:67311013-67311035 CTTGAGTCCCAGACAGGGCCTGG - Intronic
1084873502 11:72113575-72113597 CTGCTGTCCCTGAAAGAGGCTGG - Intergenic
1085538371 11:77241819-77241841 CTGTAGTCTCAGCCTGAGGCAGG + Intronic
1085592807 11:77779626-77779648 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1085626615 11:78078845-78078867 CTGTGGTCCCAGGCTGAGGGAGG - Intronic
1086526835 11:87737821-87737843 CTATATTCCCAGACAGATCCTGG + Intergenic
1087317699 11:96623342-96623364 CTCTTGTCCCTGACAGATGCAGG + Intergenic
1087769447 11:102191791-102191813 CTGTAGTCCCAGCTACAGGCGGG - Intronic
1087903195 11:103665647-103665669 CTGTAGTCCAAGACCGTGGTTGG + Intergenic
1088167176 11:106952760-106952782 CTGTAGTCCCAGATATTGGGAGG - Intronic
1088859163 11:113783787-113783809 CTGTAATCCCAGCACGAGGCAGG + Intergenic
1089685296 11:120142842-120142864 CTGTAGTCCCAGGCACTGGGAGG - Intronic
1090376938 11:126296772-126296794 CTGTAATCCCAGACTTAGGCAGG - Intronic
1090384895 11:126352040-126352062 CTGTGGTCCTAAACAGAGGCAGG + Intergenic
1090535602 11:127637991-127638013 CAGTGGTTCCAGACAGATGCTGG + Intergenic
1090822166 11:130352782-130352804 CTGTAGTCCCAGATACTGGGAGG - Intergenic
1091246099 11:134096223-134096245 CTGTAATCCCAGGCCGAGGCAGG - Intronic
1091481372 12:835214-835236 CTGTAGTCCCAGCCACTGGGAGG + Intronic
1091566761 12:1654519-1654541 CTGTAGTCCCAGCTACTGGCCGG + Intergenic
1091850410 12:3692714-3692736 CTGAACACCCACACAGAGGCAGG - Intronic
1092713670 12:11365468-11365490 CTGCAGTCCCAGTTAGTGGCAGG + Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1094680553 12:32663391-32663413 CTGTAATCCCAGGCCGAGGTGGG - Intergenic
1095402546 12:41831699-41831721 CTGTAATCCCAGACATTGGGAGG + Intergenic
1095580655 12:43793107-43793129 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1096060697 12:48697078-48697100 CTGTAATCCCAGGCTGAGGCTGG - Intronic
1096251172 12:50033362-50033384 CTTGAGTCCCAGCCAGAGGTGGG - Intergenic
1097092584 12:56519039-56519061 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
1097116554 12:56701635-56701657 CTGTCATCCCAGGCCGAGGCGGG + Intergenic
1097216513 12:57418035-57418057 CTGGAGTGCTAGAGAGAGGCAGG - Intronic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098407456 12:70141217-70141239 ATGTCGGCCCAAACAGAGGCAGG - Intergenic
1098420233 12:70288391-70288413 CTGTAATCCCAGGCCGAGGTAGG - Intronic
1098453783 12:70649829-70649851 CTGTAGTCCCAGACTTTGGGAGG - Intronic
1099479202 12:83145146-83145168 CATTAGTCCAAGCCAGAGGCTGG + Intergenic
1100635190 12:96428665-96428687 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
1101169840 12:102079919-102079941 CTTTAGTCACAGACATACGCAGG - Intronic
1101369053 12:104108194-104108216 CTGTAATCCCAGGCCAAGGCGGG + Intergenic
1101810734 12:108105573-108105595 CTGTATTCCCAGAATGAAGCAGG - Intergenic
1102741455 12:115211128-115211150 CTACAGTCCCAGACAGGGGAGGG + Intergenic
1103348594 12:120267072-120267094 CTGTAATCCCAGCAGGAGGCAGG - Intergenic
1103489246 12:121304145-121304167 CTGTAATCCTAGGCTGAGGCAGG + Intergenic
1103719427 12:122965529-122965551 CTCAAGTCCCAGAGTGAGGCTGG - Intronic
1103943204 12:124512031-124512053 CTGTAGTCCCACGCTGAGGCAGG - Intronic
1104437999 12:128771189-128771211 CTGTAGTCCCAGCAACATGCGGG + Intergenic
1104511506 12:129383559-129383581 CTGTAATCCCAGGCTGAGTCAGG - Intronic
1104582393 12:130020616-130020638 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1105290214 13:19048651-19048673 ATGCAGTCTCAGAGAGAGGCAGG + Intergenic
1105443926 13:20436563-20436585 CTGAAGGCCCAGGAAGAGGCTGG - Intronic
1106456803 13:29934981-29935003 CTGCAGGCTCAGAAAGAGGCAGG + Intergenic
1107121834 13:36804558-36804580 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
1108350630 13:49587730-49587752 CTGTAATCCCAGGCCAAGGCAGG + Intergenic
1108527776 13:51300408-51300430 CTGTAATCCCAGGCTGAGGCGGG + Intergenic
1108890367 13:55250992-55251014 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1109673583 13:65641891-65641913 CTGTAGTCCCAGAGATACTCAGG + Intergenic
1110172698 13:72521614-72521636 CTGTAGCCCCAGACAGTTGATGG + Intergenic
1110859009 13:80327428-80327450 CTGTAATCCCAGGGTGAGGCAGG - Intergenic
1110985759 13:81965844-81965866 CTGTAGTCCCAGACACAGGGAGG - Intergenic
1111580907 13:90222473-90222495 CTGTAGTCCCAGCTACGGGCGGG + Intergenic
1114283763 14:21220348-21220370 CTGTAGTACAAGGCTGAGGCAGG - Intronic
1115516602 14:34191691-34191713 TTGTAATCACAGTCAGAGGCTGG + Intronic
1117839456 14:59844045-59844067 CTGTATTCTCACAAAGAGGCAGG - Intronic
1118346319 14:64943712-64943734 CTGTGGTTCCAGACGCAGGCAGG + Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118872327 14:69753708-69753730 CTGTAGTCCCAGCTACAGGGGGG - Intronic
1119038578 14:71251723-71251745 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1120497661 14:85256673-85256695 CTGTGGTCCCAGGCTGAGGCAGG - Intergenic
1120960741 14:90122460-90122482 CTGTATTCCCAGCTACAGGCCGG - Intronic
1121572174 14:94954643-94954665 CTCTTGTCCCATACAGAGGCAGG - Intergenic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1122236220 14:100332061-100332083 CTGTAATCCCAGGCTGAGGCGGG - Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122334338 14:100959926-100959948 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
1122567898 14:102674935-102674957 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1123455445 15:20418671-20418693 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1123463542 15:20496025-20496047 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1123654520 15:22504400-22504422 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1123759399 15:23420954-23420976 CTGAGGTTCCAGACTGAGGCGGG + Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124274386 15:28313423-28313445 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1124308430 15:28599596-28599618 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1124646771 15:31442494-31442516 CGGTGGCCCCAGACAGAGACTGG - Intergenic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1124815025 15:32981367-32981389 TTGTAGTCCCAGCCGGTGGCAGG + Intronic
1125409820 15:39394253-39394275 GTGTACATCCAGACAGAGGCAGG + Intergenic
1126454302 15:48844413-48844435 GTGTGACCCCAGACAGAGGCTGG - Intronic
1128325829 15:66723428-66723450 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128878974 15:71225663-71225685 CTGTAGTCCCAGCTATAGGCTGG - Intronic
1129521033 15:76186401-76186423 CTGTTGGCCCAGTCACAGGCTGG - Intronic
1129801670 15:78419490-78419512 CTGTGGCCCCACCCAGAGGCGGG - Intergenic
1131022411 15:89110180-89110202 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1131222355 15:90595447-90595469 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1131281434 15:91024485-91024507 CTGTGAACCCAGACCGAGGCAGG + Intergenic
1132774219 16:1582973-1582995 TTGAAGTTTCAGACAGAGGCTGG + Intronic
1132859522 16:2063140-2063162 CCGAAGTCCCAGGCAGAGCCCGG - Intronic
1133238690 16:4402365-4402387 CTGTGGTCCCAGGCTGAGGCAGG - Intronic
1133324040 16:4932534-4932556 CTGTAATCCCAGCCAGATACTGG - Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133690726 16:8211900-8211922 CTGCAGTCCCAGGCCGAGGTTGG + Intergenic
1134047147 16:11109274-11109296 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1134236216 16:12468419-12468441 CTGTAATCCCAGGCTAAGGCAGG - Intronic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1134454097 16:14381352-14381374 GTGTTGTCCCAGACTGAGGGAGG + Intergenic
1134810627 16:17163924-17163946 CTGTGATCCCAGGCTGAGGCAGG + Intronic
1135221712 16:20620466-20620488 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1136135117 16:28251541-28251563 CTGTAGTCCCAGGCTGAGCCTGG + Intergenic
1136351906 16:29715866-29715888 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1136582491 16:31161547-31161569 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1136614394 16:31388222-31388244 CTGTAGTTCCAGCTACAGGCAGG + Intergenic
1136642171 16:31576034-31576056 CTGTAGTCCCAGGCTGAGACAGG + Intergenic
1136926445 16:34379659-34379681 ATGAAGTCCCAGACACAGCCTGG - Intergenic
1136978129 16:35032148-35032170 ATGAAGTCCCAGACACAGCCTGG + Intergenic
1137420856 16:48332587-48332609 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1137756930 16:50909872-50909894 CTGTAATCCCAGCGTGAGGCAGG - Intergenic
1138436415 16:57003169-57003191 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1138671515 16:58619072-58619094 CTGTAGTCCCAGCCACTGACTGG + Intronic
1141437250 16:84007224-84007246 CTGTAATCCCAGGCTGAGTCAGG + Intergenic
1141560383 16:84863843-84863865 CTGTAATCCCAGGCTGAGGTAGG + Intronic
1142395794 16:89830528-89830550 CTTAAGTCCCAGAGAAAGGCTGG - Intronic
1142553851 17:758671-758693 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143662540 17:8335344-8335366 CTGTAATCCCAGGCCAAGGCAGG + Intergenic
1143849786 17:9802297-9802319 CTGAAGTCCAACCCAGAGGCAGG + Intronic
1144040793 17:11409457-11409479 CTGTAATCCCAGGCTGAGGCGGG + Intronic
1144113776 17:12065689-12065711 CTGTAATCCCAGACTGTGGGAGG - Intronic
1144334555 17:14257087-14257109 CGGTAATCCCAGGCTGAGGCAGG - Intergenic
1144438181 17:15259824-15259846 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1144761237 17:17708768-17708790 CTGTGGTCCCAGTCACAGGCTGG + Intronic
1144804823 17:17957842-17957864 CTGTAATCCCAGGCCGAGGTGGG + Intronic
1144858291 17:18283121-18283143 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1144866187 17:18337476-18337498 GTCTAGTCCCAGCCAGGGGCTGG + Intronic
1144887641 17:18474511-18474533 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1145036441 17:19544065-19544087 CTGTAATCCCAGGCTGAGGCTGG - Intronic
1145144575 17:20469789-20469811 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145176027 17:20701191-20701213 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145227226 17:21140144-21140166 CTGTAGTCCCAGCTAGGGGGAGG - Intronic
1145743732 17:27297577-27297599 CTGTAGTACCAGGCTGAGGTGGG - Intronic
1145928840 17:28669435-28669457 CTGTAACCCCAGGCCGAGGCAGG - Intronic
1146565878 17:33912368-33912390 CTGTAGTCCCAGCTACAGGCAGG + Intronic
1146895232 17:36535767-36535789 CTGTAATGCCAGGCTGAGGCGGG - Intronic
1146975036 17:37103917-37103939 CTGTAGTCCCAGAGATACTCTGG + Intronic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148457749 17:47820097-47820119 CTGCAGTCCAGGACAGAGGGAGG + Intronic
1148644347 17:49210697-49210719 CTGGGGAGCCAGACAGAGGCTGG + Exonic
1148898791 17:50859057-50859079 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150195479 17:63293849-63293871 CTGTAGTCCGAGCCTGAGGTGGG - Intronic
1150282550 17:63937852-63937874 CTGTAGTCCCAGGCTCAGGTGGG + Intergenic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150740119 17:67772581-67772603 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1151760667 17:76100733-76100755 CTGTAATCCCAGGCCAAGGCGGG + Intronic
1151779822 17:76238169-76238191 CTGTAATCCCATAAAGAGCCAGG + Intronic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1152037797 17:77883933-77883955 CTGTAGTCCAAGAGAGAGGCAGG - Intergenic
1152173552 17:78770661-78770683 CTGTAATCCCAGGCCGAGGCAGG - Intronic
1152537641 17:80959886-80959908 CAGGAGTCCCAGGGAGAGGCAGG - Intronic
1152563874 17:81091585-81091607 CTGAAGACCCTGAGAGAGGCAGG + Intronic
1153655029 18:7274618-7274640 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1155298071 18:24403469-24403491 CTGTAGTCTGAGACTGAGACCGG + Intergenic
1155563074 18:27101468-27101490 CTGTAGTCCCAGCTACTGGCGGG + Intronic
1156199511 18:34813728-34813750 CTGTAGTCCCAGCTAGAAGCAGG + Intronic
1157677704 18:49579385-49579407 CTGTAATCTCAGGCTGAGGCAGG - Intronic
1158255089 18:55537341-55537363 CTGTAATCCCAGACCAAGGTGGG + Intronic
1158452921 18:57582798-57582820 CTGTAGTTCCAGGCTGAGACAGG + Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159158816 18:64618227-64618249 CTGTAGTCTCATACAGAGGGAGG - Intergenic
1160217395 18:76944532-76944554 CTGTAATCGCAGGCCGAGGCGGG + Intronic
1162437044 19:10667375-10667397 CTGTAGTCCCAGCTATAGGGAGG - Intronic
1162473478 19:10886314-10886336 CTGTAATCCCAGCTACAGGCTGG - Intronic
1162961871 19:14132872-14132894 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1163250684 19:16124818-16124840 CTGTGGACCCAGGCTGAGGCGGG + Intronic
1163448124 19:17359647-17359669 CTGTAATCCCAGGCCGAGGTGGG - Intronic
1163456138 19:17406682-17406704 CTGTGGTCCCAGGCTGAGGCTGG + Intronic
1163834425 19:19564507-19564529 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165357354 19:35312243-35312265 ATGCAGTCACAGACACAGGCAGG - Intronic
1165524085 19:36338111-36338133 CTGTAGTCCCAGGCTGAGGTGGG - Exonic
1165679406 19:37761094-37761116 CTGTAATCCCAGCCTGAGCCTGG + Intronic
1165693746 19:37884646-37884668 CTCTAGGCCCACACAGAGGTAGG - Intergenic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165943498 19:39427444-39427466 CTGCAATCCCAGCTAGAGGCAGG - Exonic
1165975888 19:39676373-39676395 CTGTAATCCCAGGCTGAGGCTGG + Intergenic
1166369199 19:42292030-42292052 CTGTGGCCCCAGACTGGGGCAGG - Intronic
1166540523 19:43602340-43602362 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1167238995 19:48332151-48332173 CTGTAGTCCTAAAAAGAGGCTGG - Intergenic
1167426096 19:49430520-49430542 CAGTAGTCCCGGACAGGGGGTGG + Exonic
1167467821 19:49659355-49659377 TTGTAGACCAAGACACAGGCTGG - Intergenic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1167743581 19:51338772-51338794 CCTTAGTCCAAGAAAGAGGCAGG - Intronic
1168112876 19:54204259-54204281 CTTTAATCCCAGGCTGAGGCAGG + Intronic
1168241393 19:55090887-55090909 CTGTGTTCCCAGCCAGAGGGAGG - Intergenic
1168553535 19:57319952-57319974 CTGTAGTCCTAGACACTGGGAGG - Intergenic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925295070 2:2770894-2770916 CTGTAGTCTCAGGCTGAGGCAGG - Intergenic
925317034 2:2934348-2934370 ATCCAGTCCCAGACAGATGCGGG - Intergenic
925993758 2:9275190-9275212 CTGTAATCCCAGGCTGAGGAGGG - Intronic
926480442 2:13386577-13386599 CTGTAATCTCAGGCTGAGGCAGG - Intergenic
926633571 2:15158642-15158664 CTGCAGACCCAGCCAGAGTCGGG + Intergenic
926951924 2:18252450-18252472 CTCTAGTCCCTGACTGTGGCAGG - Intronic
927257123 2:21049261-21049283 CTGTAGTCTCAAACATAGACAGG + Intergenic
927548440 2:23975748-23975770 CTGTAATCCCAGGCTGAGGTAGG - Intronic
927778786 2:25922970-25922992 CTGTAATCCCAGCTACAGGCAGG - Intergenic
927781305 2:25941469-25941491 CTGTAATCCCAGGCTGAGGTGGG + Intronic
927891355 2:26751953-26751975 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
927903717 2:26842322-26842344 CTGTAATCCCAGGCTGATGCAGG + Intergenic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
928848506 2:35710715-35710737 CTGTAATCCCAGGCTTAGGCAGG - Intergenic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929161497 2:38836968-38836990 CTGTAGTCCCAGCAAGGGGTTGG - Intronic
929230565 2:39555846-39555868 TTGTAATCCCAGGCTGAGGCAGG - Intergenic
930180426 2:48350464-48350486 CTCTAGTCCCAGGCAAAGGATGG - Intronic
930240635 2:48932578-48932600 CCGTAGTCCCTGCCACAGGCTGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
932040507 2:68294407-68294429 CTGTAATCCCAGGCTGAGGCAGG + Intronic
933911696 2:86946379-86946401 CCGTAGTCCCAGCTACAGGCTGG - Intronic
934011300 2:87823516-87823538 CCGTAGTCCCAGCTACAGGCTGG + Intronic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
935164973 2:100562597-100562619 CTGTGATCCCAGGCCGAGGCGGG - Intergenic
935304030 2:101719489-101719511 CAGCAGACCCAGACAGTGGCAGG + Intronic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935755857 2:106275859-106275881 CGTCAGTCCCAGACAGAGGCGGG - Intergenic
935774861 2:106464221-106464243 CCGTAGTCCCAGCTACAGGCTGG + Intronic
935905206 2:107831691-107831713 CTGTAGTCCCAGCTACAGGCTGG - Intronic
935991572 2:108723395-108723417 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936050887 2:109222932-109222954 CCGTAGCCCCAGGCAGGGGCAGG - Intronic
936126989 2:109796761-109796783 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936217708 2:110574725-110574747 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936426850 2:112429296-112429318 CTGTAGTCCCAGCTACAGGCTGG + Intronic
937005227 2:118506009-118506031 CTGTAATCCCAGGCTGAGGGAGG - Intergenic
937116894 2:119413021-119413043 CTGTAGTCCCAGGCAGAGGCAGG - Intergenic
938676549 2:133641565-133641587 CTGTGGTGCCAGACACAGCCAGG - Intergenic
938892011 2:135715224-135715246 CTGTAGTCCCAGCTACAGGCTGG + Intronic
940032676 2:149281116-149281138 CTGTAGTCCCAGCCATCGGGAGG - Intergenic
940052963 2:149483166-149483188 CTGGAGTGCCAGACAAAGGCAGG - Intergenic
940299927 2:152166078-152166100 CTGTAGTCCCAGATTGAACCTGG + Intronic
940610827 2:155989584-155989606 CTGTAGTCACACTCAGAAGCAGG - Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
941948650 2:171129716-171129738 CTATAGTCCCAGGCTGAGGTGGG + Intronic
942230211 2:173853826-173853848 CTGTAATCCCAGGCTGAAGCAGG + Intergenic
943274829 2:185853211-185853233 CTGTAATCCCAGGCCGAGGCAGG + Intergenic
943749838 2:191500063-191500085 CTGTATCCCCTGTCAGAGGCAGG + Intergenic
945528790 2:210924462-210924484 CTGTAATCCCAGGCAGAGGCAGG - Intergenic
945656895 2:212634962-212634984 TTGTAGTCCCAGGCTGAGGTTGG + Intergenic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
948141410 2:235674931-235674953 CTGTAATCCCAGACCGAGGGGGG - Intronic
948227964 2:236327365-236327387 GTGTAGTCCCGGGCTGAGGCAGG - Intronic
1169484069 20:6011840-6011862 CTGTAATCCCAGGCCGAGGGAGG - Intronic
1169633992 20:7666714-7666736 CTGTAGTCCCAGTCTTAGTCAGG - Intergenic
1170664338 20:18373916-18373938 CTGTAATCCCAGGCCAAGGCGGG + Intergenic
1171042866 20:21781762-21781784 GTAAACTCCCAGACAGAGGCAGG + Intergenic
1171977118 20:31602426-31602448 CTGTAATCCCAGCCTGAGGCAGG + Intergenic
1172067515 20:32232217-32232239 CTGTAATCCCAGGCCAAGGCAGG + Intronic
1172067651 20:32233134-32233156 CTCTAGCCCCAGTCAGGGGCAGG + Intronic
1172238371 20:33394272-33394294 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1172408822 20:34707882-34707904 CTGTAATCCCAGGCTGAGGCAGG - Intronic
1172577814 20:36022740-36022762 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1172632766 20:36390349-36390371 CTGGAGTCACACAGAGAGGCAGG + Intronic
1173545972 20:43898237-43898259 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
1174085417 20:48004577-48004599 CTGTAGGGGCAGACAGTGGCAGG + Intergenic
1174171172 20:48619071-48619093 CTGTGGTCCCAGGCTGAGGTGGG - Intergenic
1174287100 20:49481545-49481567 GTGAAGTCCCAGACCTAGGCTGG - Intronic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174637439 20:52013805-52013827 CTATAGTCCCAGGCTGAGGCAGG + Intergenic
1174661479 20:52216919-52216941 CTGTAGGCCAAGACAGAGTAGGG - Intergenic
1175433011 20:58920365-58920387 CTGTAGTCCCAGCTATAGGGAGG + Intergenic
1176161023 20:63648844-63648866 CTGTAGGCTCATACAGAGGAAGG + Intronic
1176259740 20:64173296-64173318 CAGCAGTCACAGACAGAGGTGGG + Intronic
1178359067 21:31933036-31933058 CTGTAGTCTCAGCTACAGGCTGG - Intronic
1178361706 21:31953963-31953985 CTGTGGTCCCAGCCAGATGATGG + Intronic
1178574804 21:33776436-33776458 CTGTAGTACCTGCCTGAGGCAGG + Intronic
1178681495 21:34675989-34676011 CTGTCAGCCCAGACAGAGACGGG - Intronic
1180231038 21:46426848-46426870 CTTTGATCCCAGTCAGAGGCAGG - Intronic
1181035204 22:20166658-20166680 CTGCAGTCCTGGACAGTGGCTGG + Intergenic
1181489994 22:23255695-23255717 CTGTACTCCAAGTCAGAGCCAGG - Intronic
1181491222 22:23262060-23262082 CTGTAGTCCCAGCCACACACAGG - Intronic
1181594649 22:23906474-23906496 CTTAGGGCCCAGACAGAGGCAGG - Intergenic
1181687789 22:24541505-24541527 CTGTAGTCCCAGCTAGTGGGGGG + Intronic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1181985502 22:26797533-26797555 CTGTTCACCCAGACACAGGCTGG + Intergenic
1182340897 22:29620005-29620027 CTGTAATCCCAGTGGGAGGCCGG + Intronic
1182362287 22:29753823-29753845 CCATGTTCCCAGACAGAGGCTGG + Intronic
1182656540 22:31894893-31894915 CTGTAATCCCGGGCCGAGGCAGG + Intronic
1182803403 22:33050579-33050601 CTGTGGTCCCAGACAGTGAGTGG + Intronic
1183170598 22:36184882-36184904 GTGTAGTCATAGAGAGAGGCTGG - Intergenic
1183529126 22:38343125-38343147 CTGTAATCCCAGGCTGAAGCGGG + Intronic
1185062982 22:48616700-48616722 CTGCAGCCCTAGACAGAGGGTGG - Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185171233 22:49295827-49295849 CCGGAGTCCAAGCCAGAGGCAGG + Intergenic
949535179 3:4989707-4989729 CTTTGGTCCCAGCCTGAGGCTGG - Intergenic
949951115 3:9229442-9229464 GTGTGGGCCCGGACAGAGGCCGG + Intronic
950093429 3:10313588-10313610 CTGTTGTCCCAGCCAGAGGGAGG - Intronic
950383978 3:12641897-12641919 CTGTAATCCCAGCCTGAGGCAGG + Intronic
950453179 3:13077147-13077169 CTATAGTCCCAGGCTAAGGCAGG - Intergenic
951456971 3:22903714-22903736 CTGTAATCCCAGCTACAGGCCGG + Intergenic
952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG + Intergenic
953200294 3:40772267-40772289 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953247166 3:41204593-41204615 CTATATTCCCACACAGTGGCTGG - Intronic
953331036 3:42053352-42053374 CTGCAGTCCCATTCAGAGTCGGG + Intronic
954189749 3:48949362-48949384 CTGTAATCCCAGGCCAAGGCAGG - Intronic
954282986 3:49597450-49597472 CTGTAGTCCCAGCTACTGGCAGG - Intronic
954640803 3:52096674-52096696 CTGTCCCCCCAGGCAGAGGCAGG - Exonic
956286731 3:67618295-67618317 CTGTAGTCCCAGCTACAGGGAGG + Intronic
957478701 3:80761458-80761480 CTGTAGTCCCAGTACTAGGCAGG + Intergenic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
957855137 3:85865228-85865250 CAGTGCTCCCAGACAGAGACAGG - Intronic
958268525 3:91469247-91469269 CTAGAGTCACAGACAGAGCCTGG + Intergenic
958792156 3:98664281-98664303 CTGTAATCCCAGGCTGAGACAGG - Intergenic
959984605 3:112558859-112558881 CTGTAATCCCAGCTACAGGCAGG - Intronic
961004255 3:123394016-123394038 CTGTAATCCCAAGCTGAGGCAGG + Intronic
961846841 3:129772233-129772255 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
964547510 3:157850374-157850396 CTGTAGTCCCAGCCACTGGGAGG - Intergenic
965550533 3:169960507-169960529 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
965668428 3:171120881-171120903 CCGTAGTCCCAGAGAGCAGCAGG + Intronic
965863049 3:173170208-173170230 CTGTGGTCCCAGACAAAGGTGGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
966405026 3:179587744-179587766 CTGGAGTCCCAGGCTGAGGTGGG + Intronic
967066379 3:185920664-185920686 CTGTAGTCCCAGCTACTGGCAGG - Intronic
967418337 3:189244305-189244327 CTGTAATCCCAGGCTGAGACAGG + Intronic
967726907 3:192870597-192870619 CTGTAATCCCAGGCTGAGGCAGG + Intronic
967733992 3:192933206-192933228 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
968112714 3:196062283-196062305 CTGTAATCCCAGGCCGAGGCAGG + Intronic
968142215 3:196267456-196267478 CTGTAATCCCACACTGTGGCAGG + Intronic
968147525 3:196312001-196312023 CTGTAATCCCAGGCTGAGACAGG - Intronic
969294408 4:6261329-6261351 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
969511839 4:7622542-7622564 CTGGAGTCCCAGGCAGGGGCTGG + Intronic
969843142 4:9898538-9898560 CTGTAGTCCCTGAGAAAGTCAGG - Intronic
970968912 4:21958928-21958950 CTGGAGTTCCAGAGAGAGACTGG + Intergenic
972409918 4:38783293-38783315 CTGTAGTCCCAGACATTTGCGGG - Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
972774839 4:42231113-42231135 CTATAATCCCAGGCTGAGGCGGG - Intergenic
973685089 4:53361641-53361663 CTGTAATTCCAGGCTGAGGCTGG - Intronic
974920571 4:68234047-68234069 TTGTAGTCCCAGGCTGAGGCAGG + Intronic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
976248443 4:83026634-83026656 CTGTAGTCCCAGCTAGCAGCTGG - Intergenic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
978596486 4:110382572-110382594 CTGTGGTCCAAGAGAGTGGCTGG - Intronic
979156121 4:117392637-117392659 CTCTAGACCCACACAGAGCCAGG + Intergenic
979699191 4:123648567-123648589 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
980115586 4:128676028-128676050 CTGTAGTCCTAGGCTGAGGCAGG - Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980380765 4:132012029-132012051 CTGTAATTCCAGGCCGAGGCAGG + Intergenic
981786663 4:148487185-148487207 CTGTAATCCCATAATGAGGCAGG - Intergenic
983799913 4:171914540-171914562 CTATAATCCCAGGCTGAGGCAGG - Intronic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
984974803 4:185220987-185221009 CTGTAGTCCCAGCCATTGGCGGG - Intronic
985588038 5:751024-751046 CTCTTGTCCCAGGGAGAGGCCGG - Intronic
985602707 5:843491-843513 CTCTTGTCCCAGGGAGAGGCCGG - Intronic
985604139 5:849602-849624 CTGGAGTCCCCGAGAGAGTCCGG - Intronic
985941177 5:3137456-3137478 CTGTAATCCAAGGCAGAGGCAGG + Intergenic
986169082 5:5301324-5301346 CTGTAATTCCAGGCTGAGGCAGG - Intronic
986877757 5:12132086-12132108 CTGCAGTTCTAGACTGAGGCAGG + Intergenic
987026028 5:13927367-13927389 CTGTAGTCCCAGCTACAGGCTGG + Intronic
987210134 5:15673067-15673089 CTGTAATCCCAGGCCGAGGAAGG + Intronic
987660923 5:20874691-20874713 CTGTAGTCCAAGATTGTGGCTGG + Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988762717 5:34330994-34331016 CTGTAGTCCAAGATTGTGGCTGG - Intergenic
989219271 5:38937153-38937175 CTGTAGTCCCAGCTACAGGGAGG - Intronic
989626945 5:43438653-43438675 CTGTAATCCAAGGCTGAGGCAGG + Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
991078874 5:62573138-62573160 CTGTAGTCCCAGCTACAAGCCGG - Intronic
991374891 5:65956486-65956508 CTGCAGTCCCAGGCTGAGGTGGG - Intronic
992071845 5:73155700-73155722 CTGTTCTCCCAGCCATAGGCAGG - Intergenic
992237260 5:74723712-74723734 CTGTAGTACCAGATGAAGGCAGG - Intronic
992427830 5:76676387-76676409 CTGCTTTCCCAGCCAGAGGCTGG - Intronic
992603075 5:78424606-78424628 CTGTAATCCCAGCTCGAGGCAGG + Intronic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
992812803 5:80407083-80407105 CTGTAGTCCCAGCTACTGGCTGG - Intergenic
992863688 5:80937287-80937309 CTGGAGCCCCTGACAGAAGCTGG - Intergenic
994065683 5:95539043-95539065 CTGTAGTCTCATACGGAGTCTGG - Intronic
995869282 5:116727111-116727133 CTGATGTCCCAGACAGAAGCTGG - Intergenic
996069473 5:119118485-119118507 CTGTAATCCCAGGATGAGGCGGG + Intronic
996709308 5:126528325-126528347 CTGTAATCCCAGGCTGAGGCAGG + Intergenic
996928801 5:128861359-128861381 CTGTAGTCCCAGCCACTGGGAGG - Intronic
998800420 5:145863742-145863764 TTGTAATCCCAGGCAGAGGAGGG - Intronic
998990028 5:147805523-147805545 CTGTAATCCCAGACATTGGGAGG - Intergenic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999291032 5:150426529-150426551 CTGTAATCCCAGCTACAGGCTGG - Intergenic
999665298 5:153906441-153906463 CAGTAGGCCCAGGCAGAGGTGGG - Intergenic
999681048 5:154060476-154060498 CTGTAGTCCCAGCTACAGGCAGG - Intronic
1000597474 5:163232439-163232461 CTGTATTCCCAGCTACAGGCTGG - Intergenic
1001915854 5:175559439-175559461 CTGCAGTCCCAGCTACAGGCTGG - Intergenic
1002033090 5:176445396-176445418 CTGTAGTCCCAGGCCGAGGCAGG - Intergenic
1002893570 6:1359880-1359902 CTGTAATCCAAGGCTGAGGCGGG + Intergenic
1003450186 6:6223510-6223532 CTGAAGTTCCAGATAGAAGCCGG - Intronic
1003455067 6:6274691-6274713 CAGTAGTCCCAGGAAGAGGCTGG - Intronic
1003666979 6:8120635-8120657 CTGTAGTGGCAAACAGAGCCAGG + Intergenic
1003864567 6:10351271-10351293 CTGTAATCCCAGGCCGAGGCGGG + Intergenic
1004399815 6:15278108-15278130 CTGTAATCCCAGGCTGAAGCAGG + Intronic
1004402001 6:15297392-15297414 TTGTAATCCCAGGCCGAGGCGGG - Intronic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1004941522 6:20562490-20562512 CTGTAATCCCAGGCTGAGGTGGG + Intronic
1004992684 6:21156299-21156321 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1005994313 6:30922260-30922282 CTGGAGTCACAGAAAGCGGCAGG - Intronic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006429200 6:33984744-33984766 CTGGAGCCCCGGAGAGAGGCTGG + Intergenic
1006990887 6:38213858-38213880 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1007444051 6:41890588-41890610 CTGTAGTCCCAGAGAGGTCCAGG + Intronic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1007620446 6:43210231-43210253 CTGTAGTCCCAGACTTTGGCAGG - Intronic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008611426 6:53187849-53187871 CTGTAATCCCAGCTACAGGCAGG + Intergenic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1008986679 6:57552334-57552356 CTAGAGTCACAGACAGAGCCTGG - Intronic
1009174640 6:60444901-60444923 CTAGAGTCACAGACAGAGCCTGG - Intergenic
1009870499 6:69447136-69447158 AAGTAGTCACAGACAGAGGCAGG + Intergenic
1010052067 6:71517451-71517473 GTGTAGTCCTACACAGAGTCAGG + Intergenic
1010202328 6:73293706-73293728 GTGTAATCCCAGCCATAGGCTGG + Intronic
1011273064 6:85599694-85599716 CTGTGGTCCCAGGCTGAGGTGGG + Intronic
1011458260 6:87575923-87575945 CTGTAATCCCAGGCTGAAGCAGG - Intronic
1012462617 6:99480550-99480572 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1012996528 6:105981224-105981246 ATGTATTCCCAGACGGATGCGGG + Intergenic
1014806024 6:125830565-125830587 CTGTAGTCCCAGTTACTGGCAGG + Intronic
1015659978 6:135564857-135564879 TTGTAGTACCTGAAAGAGGCAGG - Intergenic
1016013069 6:139158557-139158579 CTGTAGTCCCATGCTGAGGTGGG + Intronic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1017877936 6:158538934-158538956 CTGTGGTCAGAGAGAGAGGCTGG + Intronic
1017917720 6:158845421-158845443 CTGTAGTCCCAGACTATGGGAGG - Intergenic
1018289168 6:162272873-162272895 CTGTAATCCCAGCTACAGGCTGG + Intronic
1018754929 6:166840713-166840735 CTGTAATCCCAGGCTTAGGCGGG + Intronic
1018953563 6:168393674-168393696 CTGTGTTCCCACACACAGGCTGG - Intergenic
1020226734 7:6286172-6286194 CTGTAATCCCAGGCTGAGGCAGG - Intergenic
1020844148 7:13261525-13261547 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1021456327 7:20832872-20832894 CTGTAGTCCCAGCCAGCTACTGG + Intergenic
1021689340 7:23217093-23217115 CTGTAGTCCCAGATACTGGGTGG - Intergenic
1022320557 7:29284034-29284056 CTGTAGTCCCAGCTACAGACAGG - Intronic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1022876248 7:34533649-34533671 CTCTTGTCCCTGACAGATGCAGG + Intergenic
1023497403 7:40813058-40813080 CTGTAGTCCCAGAGTGTGGTTGG + Intronic
1023858530 7:44201402-44201424 CTGGTGTCCGAGTCAGAGGCGGG + Intronic
1023958321 7:44905757-44905779 ATGGAGTCTGAGACAGAGGCAGG - Intergenic
1026666374 7:72343298-72343320 CTGTAATCCCAGGCCGACGCGGG + Intronic
1027195438 7:76026936-76026958 CTGTAATCCCAGCTACAGGCTGG + Intronic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1027997772 7:85447733-85447755 CTATAGTCCCAGCTACAGGCTGG - Intergenic
1028024431 7:85820078-85820100 CTGTAGTCCCATTCTGAGGCAGG + Intergenic
1028598645 7:92575349-92575371 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1028611133 7:92712979-92713001 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1028673843 7:93435559-93435581 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1028872555 7:95785163-95785185 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1029132617 7:98344053-98344075 CTGTAGTCCCAGCTATAGGGAGG + Intronic
1029250248 7:99231193-99231215 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1031928188 7:127658063-127658085 CTGTAATCCCAGGCCGAAGCAGG + Intronic
1031978137 7:128106688-128106710 CTGAGGTACCAGACAGATGCTGG + Intergenic
1032211342 7:129917080-129917102 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1032744631 7:134773394-134773416 CTGTAGTCCCAGCCCTAGGGAGG - Intronic
1033074861 7:138239375-138239397 CTGTGGCCCCACCCAGAGGCTGG - Intergenic
1033105368 7:138516475-138516497 CTGTAATCCCAGTTACAGGCAGG - Intronic
1034330418 7:150277796-150277818 CTGTAGAACCACGCAGAGGCAGG - Intronic
1034628332 7:152511452-152511474 CTGTAATGCCAGGCTGAGGCAGG - Intergenic
1034680950 7:152926754-152926776 CTGTAATCCCAGGCTGAGGGAGG + Intergenic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035077643 7:156191532-156191554 CTGCAAAACCAGACAGAGGCTGG - Intergenic
1037419354 8:18685885-18685907 CTTTATCCCCACACAGAGGCAGG - Intronic
1038543832 8:28410966-28410988 CTGTAATCCCAGGCTGAGGCAGG + Intronic
1039625572 8:39048165-39048187 CTGTAATCCCAGACCAAGGCGGG - Intronic
1040838237 8:51754967-51754989 CTGTAATCCCAGTCTCAGGCAGG - Intronic
1041241947 8:55855590-55855612 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1041442092 8:57908073-57908095 CTGTAATCCCAGGCCGAGGCGGG - Intergenic
1042346052 8:67729149-67729171 CTGCAGTCCCAGGTAGAGCCTGG - Intronic
1043382833 8:79721723-79721745 CTGGAGTCACGGACAGACGCTGG + Intergenic
1044006244 8:86940421-86940443 CTGTAATCCCAGGCCGAGGGAGG - Intronic
1044602400 8:94018650-94018672 CTGTGATCCCAGTCAAAGGCTGG + Intergenic
1045366507 8:101481309-101481331 CTGTAGTCCCAGGCAAAGGTGGG - Intergenic
1045472639 8:102526045-102526067 CTGTAGTCCCAGGCTGCAGCAGG - Intergenic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1048745387 8:137609279-137609301 CTGTAATCCCAGCTACAGGCAGG - Intergenic
1049091093 8:140514026-140514048 CTGTAATCCCAGCCAGCGGGAGG - Intronic
1049141809 8:140961994-140962016 CTGTAATCCCAGGCAGAGACAGG + Intronic
1049536976 8:143186986-143187008 CTGGACTCCCAGACAGATGACGG - Intergenic
1049971144 9:823190-823212 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1050565050 9:6873241-6873263 CTGTAATCCCAGGCCGAGGCGGG - Intronic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1051647538 9:19283716-19283738 CTGTAGTCCCAGCTACTGGCGGG - Intronic
1052296935 9:26907281-26907303 CTGTAATCCCAGGCTGAGGCGGG + Intronic
1052936714 9:34099352-34099374 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1052985011 9:34480522-34480544 CTGTAATCCCAGGCTGAGGTGGG - Intronic
1053238609 9:36477698-36477720 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1054254542 9:62800297-62800319 CTGGAGTCCCAGCGAGAGGGTGG - Intergenic
1055444481 9:76369044-76369066 CTGTAATCCCAGGCCGAGGCAGG - Intergenic
1055607421 9:77985185-77985207 CTGTAGTCCCAGCTATAGGCTGG + Intronic
1055739940 9:79376910-79376932 CTGTGGTCCCAGGCTGAGGCAGG + Intergenic
1056762021 9:89422471-89422493 CTGAAGTCCAAGAGAGAGGCTGG + Intronic
1057040042 9:91841453-91841475 CTGCAGTCCCTGACACAGACTGG + Intronic
1057210178 9:93196882-93196904 CTGCAGGCCCAGGCAGAGGAGGG - Intronic
1057831233 9:98408897-98408919 CTGTAATCGCAGGCTGAGGCAGG - Intronic
1058858309 9:109088571-109088593 CTGTAATCCCAGGCCGAGGCGGG + Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059428274 9:114234818-114234840 CTGTAATCCCAGCACGAGGCGGG + Intronic
1059464893 9:114462201-114462223 CTGTAGACCCAGCTACAGGCAGG - Intronic
1060140645 9:121206859-121206881 CTGTGGTCCCAGGCTGAGGTGGG - Intronic
1060608666 9:124940970-124940992 CTGGCTTCCCAGAGAGAGGCAGG - Exonic
1060693526 9:125686198-125686220 CTGTACTCCCAGGCTGAGGCGGG + Intronic
1060694827 9:125699742-125699764 CTGTAGTTCCAGGCTGAGGTAGG - Intronic
1060881796 9:127122777-127122799 CCTCAGCCCCAGACAGAGGCGGG + Exonic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1061416999 9:130452398-130452420 CTGACAACCCAGACAGAGGCTGG - Intronic
1061589255 9:131588196-131588218 GTGTCGTCCCGGAGAGAGGCAGG - Intronic
1061705142 9:132447294-132447316 CTGCATCCCCAGAAAGAGGCAGG - Intronic
1061723711 9:132569856-132569878 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1061862176 9:133473697-133473719 CTCTAGTCCCAGACACGAGCTGG - Intronic
1062163813 9:135095560-135095582 CTGTAGCTCCAGGCACAGGCTGG - Intronic
1062313653 9:135954197-135954219 CTGTAATCCCAGCACGAGGCAGG + Intronic
1185532121 X:830340-830362 CTGTAATCCCAGCACGAGGCAGG + Intergenic
1186218331 X:7323896-7323918 GTGTAATCACAGAGAGAGGCTGG - Intronic
1187605761 X:20880962-20880984 CTCTAGTCCCAGAAAGAGAAGGG - Intergenic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1189314673 X:40046271-40046293 CTGTAATCCCAGGCCAAGGCGGG + Intergenic
1189808913 X:44762940-44762962 CTGTAGTCCCAGGCTGAGGGAGG + Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190832599 X:54072860-54072882 CTGAAGTCCCAGAAACAGGCAGG + Exonic
1192453568 X:71258987-71259009 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1192778095 X:74266010-74266032 CTGTAGTCCCAGGCTGACGTAGG - Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1194373707 X:93107189-93107211 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic
1194705106 X:97165747-97165769 CTGTAATCTCAGGCCGAGGCGGG - Intronic
1194941056 X:100010509-100010531 CTGTAGTCCCAGCCAGTGAGGGG - Intergenic
1195034519 X:100960233-100960255 CTGTAATCCCAGGCTGAGGTGGG + Intergenic
1195097008 X:101512257-101512279 CTGTAATCTCAGGCTGAGGCAGG + Intronic
1195318584 X:103702366-103702388 CTTTGGTACCAGACAGAGCCTGG - Intergenic
1195563063 X:106307020-106307042 CTGTAGTCCCAGCCATTGGGAGG - Intergenic
1195855626 X:109329354-109329376 CTGTGGTCCAAGACAGTGGTTGG + Intergenic
1196176165 X:112641310-112641332 GTCAAGTCCCAGCCAGAGGCAGG + Intronic
1196471237 X:116031046-116031068 CTGGATTACCAGACAGAGACTGG + Intergenic
1197406715 X:126062773-126062795 CTGTGGTCTGAGACAGAGGTTGG - Intergenic
1198102562 X:133434809-133434831 CTGTAGCCTGAGACTGAGGCAGG - Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1199137114 X:144266331-144266353 CTGAACACCCACACAGAGGCTGG + Intergenic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic
1200681736 Y:6221223-6221245 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic
1200794521 Y:7328615-7328637 CTGTAATCCCAGGCCGAGGAGGG - Intergenic
1201354245 Y:13081471-13081493 CTGTAATCCCAGGCTGAGGCAGG - Intergenic