ID: 972546249

View in Genome Browser
Species Human (GRCh38)
Location 4:40083109-40083131
Sequence GGCGGTGCAGACATAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972546240_972546249 7 Left 972546240 4:40083079-40083101 CCTGTTCTGTATTATGAAGCGGG No data
Right 972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 162
972546236_972546249 19 Left 972546236 4:40083067-40083089 CCACGCCCTGTGCCTGTTCTGTA 0: 1
1: 0
2: 2
3: 23
4: 204
Right 972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 162
972546237_972546249 14 Left 972546237 4:40083072-40083094 CCCTGTGCCTGTTCTGTATTATG No data
Right 972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 162
972546235_972546249 20 Left 972546235 4:40083066-40083088 CCCACGCCCTGTGCCTGTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 175
Right 972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 162
972546238_972546249 13 Left 972546238 4:40083073-40083095 CCTGTGCCTGTTCTGTATTATGA 0: 1
1: 0
2: 3
3: 12
4: 148
Right 972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972546249 Original CRISPR GGCGGTGCAGACATAGAAAA AGG Intronic