ID: 972549801

View in Genome Browser
Species Human (GRCh38)
Location 4:40120772-40120794
Sequence ATCTGATTCTTTAGCTCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972549801 Original CRISPR ATCTGATTCTTTAGCTCAGA GGG Exonic
901735086 1:11307060-11307082 TCCTGATTCAATAGCTCAGAAGG + Intergenic
906207661 1:43995771-43995793 TTCTGTTCCTTTAGCTCTGAAGG - Exonic
906764624 1:48417018-48417040 GTCTTACTCTTTATCTCAGAGGG - Intronic
907185684 1:52607408-52607430 ATCTGGTATTTTAGCTTAGAAGG - Intronic
907224377 1:52930755-52930777 ATCTGACTCTGAGGCTCAGAGGG + Intronic
908094168 1:60719678-60719700 ATCTATTTCTCTATCTCAGAAGG + Intergenic
908162644 1:61426110-61426132 ATCCTATTCTTTAGAGCAGAGGG - Intronic
908306412 1:62823545-62823567 ATCAGTTTCTTTTGATCAGATGG - Intronic
911284488 1:95973897-95973919 ACATGCTTCTTTAGCTCAGCGGG + Intergenic
911936919 1:103988366-103988388 AGCTGATTCTAAAGCTCACATGG + Intergenic
912317786 1:108681928-108681950 ATTTGATTTTTTAGATAAGATGG - Intergenic
912621073 1:111158769-111158791 ATAAGATTCTTTAGATTAGAAGG - Intronic
914315062 1:146502622-146502644 ATCTGAGTCTTAAGCTAAGGTGG + Intergenic
914499292 1:148230749-148230771 ATCTGAGTCTTAAGCTAAGGTGG - Intergenic
916250754 1:162735465-162735487 TTCTGATTCATTAGGTCAAATGG + Intronic
917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG + Intergenic
917478392 1:175388368-175388390 ATGTGATTATGTAGCGCAGAGGG + Intronic
917497095 1:175550363-175550385 ATCTGATTCAGCATCTCAGAGGG - Intronic
918876514 1:190052384-190052406 AACTGATTCTTAAGGCCAGATGG + Intergenic
919292460 1:195650059-195650081 ATCTGGCTCCTTAGCTCAGTGGG - Intergenic
921952794 1:220949046-220949068 ACCTCATTCTTAATCTCAGAGGG + Intergenic
922271776 1:224042146-224042168 ACCTGATCCTGAAGCTCAGATGG - Intergenic
922577501 1:226672249-226672271 AGGTGATTATTTAGCTCAGGCGG - Intronic
923730652 1:236546757-236546779 GCCTGATGCTATAGCTCAGAAGG - Intronic
923931786 1:238708105-238708127 ATCTTAGTCTTCAACTCAGAGGG - Intergenic
1062827012 10:577937-577959 ATCTGATTTTTCAGAACAGAAGG - Intronic
1068003418 10:51364077-51364099 ATCTAATTCTTGTGCTAAGAAGG - Intronic
1069790895 10:71019939-71019961 AACTTATTCTTTACCTTAGAAGG + Intergenic
1073023703 10:100469995-100470017 ATCTGAAGATTTAGCACAGAAGG - Intronic
1073031140 10:100526905-100526927 TGGCGATTCTTTAGCTCAGATGG - Intronic
1073704671 10:105969740-105969762 TTCTGATTCTTGAGCCCAGCTGG + Intergenic
1073836769 10:107453285-107453307 ATCTCATCCTTTTGCTAAGATGG + Intergenic
1073965235 10:108981266-108981288 TTCTGATTCTATTGCACAGAAGG - Intergenic
1075953332 10:126500998-126501020 ATCTGATTCTTTGTATCTGAAGG - Intronic
1076977517 11:186027-186049 ATATGATTACTTAGCTAAGAGGG + Intronic
1077840153 11:5965539-5965561 ATTTGATTCTTTCCCTAAGAAGG + Intergenic
1079459128 11:20664444-20664466 AACTTATTCTTTAGAGCAGAGGG + Intergenic
1082309603 11:50630784-50630806 ATCTGAGGCTTTAGATCAGGTGG - Intergenic
1083336738 11:61926556-61926578 ATCTGATTCTTTTTTTGAGATGG + Intergenic
1084929669 11:72544628-72544650 AACTTGTTCTTTATCTCAGAAGG + Intergenic
1086393711 11:86392217-86392239 AACTGATTCTCTTCCTCAGAGGG - Intronic
1087915837 11:103809857-103809879 ATCTGAATCTTATACTCAGATGG - Intergenic
1088092787 11:106062908-106062930 AACTAATTCTTTACCTCACAAGG + Intronic
1088558091 11:111083369-111083391 TGCTGATTCTTTCTCTCAGAAGG - Intergenic
1089563721 11:119359264-119359286 ATCTGGGTCTTGAACTCAGATGG + Exonic
1089870583 11:121669186-121669208 TTCTGGTTCATTAGCTGAGACGG - Intergenic
1091176830 11:133566489-133566511 TTCTGTGTCTTTAGCTCAGTAGG - Intergenic
1093936899 12:25011102-25011124 ACCTGTTTCTTTATCTGAGATGG - Intergenic
1097556047 12:61138962-61138984 ATCTGTTTCTTTATCTCATCTGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105268347 13:18844283-18844305 ACCTGATTCATCAGATCAGAGGG + Intergenic
1106805369 13:33301285-33301307 ATCTGATTACTCAGCACAGATGG + Intronic
1108203655 13:48066711-48066733 ATCAGATACTTTTGCACAGAGGG + Intronic
1108542705 13:51458763-51458785 ATCTGATTATTCTGCTCAGATGG - Intergenic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1110118438 13:71849500-71849522 ATGTGATTTATTAGCTAAGATGG + Intronic
1112377016 13:98852395-98852417 GCCTGACTTTTTAGCTCAGATGG - Intronic
1116599342 14:46899420-46899442 ATTTGATTCTTGAACTCAGGTGG + Intronic
1118910959 14:70061613-70061635 TTCTCATTCTTTATCTCATAGGG + Intronic
1119224988 14:72938186-72938208 TTCTGATTCTGTAGGTCTGAGGG + Intronic
1120112752 14:80577325-80577347 ATTTGAGTCTGGAGCTCAGAAGG - Intronic
1124666859 15:31599688-31599710 ATATGTTCCTTTAGCTCAGAGGG - Intronic
1125671940 15:41480069-41480091 TTCTGATTCCTTCTCTCAGAGGG - Intronic
1126482201 15:49137434-49137456 TTCTGATTTTTTATGTCAGATGG - Exonic
1127152280 15:56088775-56088797 ACCTGATTTTTCAGCTCATAGGG + Exonic
1127459376 15:59184011-59184033 ATCTCATTCTTTTTCTGAGACGG + Intronic
1128157972 15:65403789-65403811 TTCTATTTCTTTAGCCCAGAGGG - Intronic
1128762451 15:70226584-70226606 ATCCAATTTTTTAGCTGAGAAGG - Intergenic
1129634782 15:77304176-77304198 AACTGATTCTAAAGCTCATAAGG - Intronic
1129709209 15:77811672-77811694 ATCAGATTCTTTATCTCCCAAGG + Intronic
1132020883 15:98361293-98361315 ATCTGATTCTAAAGTTCATATGG + Intergenic
1133691295 16:8218117-8218139 AGCTGTTTCTTTAGCTCAGAGGG + Intergenic
1135873472 16:26174269-26174291 GTCTTGTTCTTTAACTCAGAAGG + Intergenic
1137393333 16:48099474-48099496 ATCTAATTCTTTCTCTCTGAAGG + Intronic
1138658240 16:58502814-58502836 ATCGGTTTATTTAGCTCAGATGG + Intronic
1143960807 17:10717254-10717276 ATCTCATTCCTGATCTCAGAGGG + Intronic
1144448037 17:15349405-15349427 ATCTGCTTCTTTAGGTTATAAGG - Intergenic
1144843775 17:18205206-18205228 ATTTCTTTCTTTTGCTCAGATGG + Intronic
1145003240 17:19320278-19320300 GTCTGTTTCTCTATCTCAGAGGG + Intronic
1149525906 17:57355631-57355653 ACATGATTCTTTTGCTCTGAGGG + Intronic
1151484935 17:74393105-74393127 TTCTGATGCCTTGGCTCAGAGGG - Intergenic
1154075515 18:11196918-11196940 AGCTGATTCTATAATTCAGATGG - Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1164557321 19:29263569-29263591 ACCTGATTCTATAGCTCACAAGG - Intergenic
1166424305 19:42662204-42662226 TTCTTCTTCTTTGGCTCAGAGGG + Intronic
1168432197 19:56290195-56290217 TTCTGATGGTTTGGCTCAGATGG + Intronic
925553328 2:5100346-5100368 AGCTGATTCTAAAGCTCATATGG - Intergenic
925676173 2:6363262-6363284 GTCTCATTCTGTGGCTCAGACGG - Intergenic
926374655 2:12214683-12214705 ATCTGATTCCTAAGCTCATTAGG + Intergenic
926479709 2:13377295-13377317 ATCTGATTTTTTAGCTACAAGGG + Intergenic
928104910 2:28463520-28463542 CTTTGATTCTTTAGGCCAGAAGG + Intronic
928309108 2:30195060-30195082 GTCTGATTCTGTAGGTCTGAAGG + Intergenic
928917146 2:36484373-36484395 AGCTGATTCTTAATGTCAGAGGG + Intronic
929351585 2:40962591-40962613 TTTCTATTCTTTAGCTCAGAGGG - Intergenic
929971860 2:46586172-46586194 ATCTGTATCCTTACCTCAGAAGG + Intronic
932921370 2:75918397-75918419 ATGTTATTCTTTTTCTCAGATGG + Intergenic
935852059 2:107233039-107233061 ATCTGATCCTTTATGTCTGAAGG + Intergenic
936842895 2:116795080-116795102 ATCTGTTACTTTATGTCAGAGGG + Intergenic
938402746 2:131006321-131006343 ATCTGTTTCTGTAGGTCAAAGGG - Intronic
938708240 2:133952582-133952604 AGATGATTATTTAGCTCAGGAGG - Intergenic
939633412 2:144552173-144552195 AACTTATTCTTTACCTTAGAAGG + Intergenic
941028929 2:160490738-160490760 ATCTAATTCTTTTAATCAGAAGG - Intronic
943466367 2:188234194-188234216 ATTTGATTATTTACATCAGAAGG - Intergenic
943863549 2:192898194-192898216 ATCTGATTCTTTATTTTGGAAGG - Intergenic
944038991 2:195333795-195333817 AGCTGATTTTTTTGCACAGAAGG - Intergenic
944916388 2:204364904-204364926 ATCAGATTCTTCAGCTTAGCTGG + Intergenic
945210747 2:207380129-207380151 ACTTGTTCCTTTAGCTCAGAGGG + Intergenic
946516960 2:220423173-220423195 ATCTGATTTTCAAGGTCAGATGG - Intergenic
1170649987 20:18230434-18230456 ATTTGATCCTTTCTCTCAGAAGG - Intergenic
1171233571 20:23507189-23507211 ATATGATTCTGGAGTTCAGAAGG - Intergenic
1173451665 20:43169800-43169822 ATTTGATTTCTAAGCTCAGAAGG - Intronic
1177071052 21:16508710-16508732 ATGTGTTTCTTAAGCTCAAAGGG + Intergenic
1179008218 21:37532871-37532893 ATGTGAATCTTTAACTAAGATGG - Intergenic
1179276696 21:39898350-39898372 CTATGTTACTTTAGCTCAGATGG - Intronic
1182131642 22:27857469-27857491 ATCAGATTCTTTGGCACAAAAGG - Intronic
1184194654 22:42918888-42918910 ATGTGTTTCTTCAGCTGAGAGGG - Intronic
949196476 3:1315526-1315548 AGCTGGGTATTTAGCTCAGATGG + Intronic
950735242 3:15002144-15002166 ATCTTATTCTTAACCTTAGAAGG + Intronic
950892033 3:16412746-16412768 AAGGGATTCTCTAGCTCAGAGGG - Intronic
953794968 3:45977842-45977864 ATCTGGGTCTTTAACTGAGAGGG - Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957320738 3:78627283-78627305 ATCTGATTTGTTAGCAAAGAAGG + Intronic
958112754 3:89170964-89170986 ATCTGATACTTTTGCTTAGCTGG + Intronic
959093732 3:101931182-101931204 ATGTGATTCTTTAGGTCATCTGG - Intergenic
962096598 3:132299026-132299048 ATCTGCTTCTTGAGCTAACAGGG + Intergenic
963316946 3:143769626-143769648 TTTTTATTCTTTAGCTCACATGG - Intronic
965946891 3:174253788-174253810 ATATGGATCTTCAGCTCAGAGGG - Intronic
968040130 3:195581779-195581801 AACAGATTCTTTACCTCAGTAGG + Intronic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
971270390 4:25138845-25138867 TTCAGATTCATTAGATCAGAAGG - Intronic
972306608 4:37836644-37836666 ATCTGATTGTTTAACTCACAGGG + Intronic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
975110164 4:70614521-70614543 AACTTACTCTTTGGCTCAGAGGG + Intergenic
975178041 4:71309880-71309902 ACATGCTTCTTTAGCTCAGAGGG - Intronic
977357037 4:95959451-95959473 ATCTGATTATTTAAATAAGATGG + Intergenic
977793064 4:101129947-101129969 ACATGCTTCTTTAGCTCAGGAGG - Intronic
978730580 4:112021768-112021790 ATCAGAATCTTTAGAACAGAGGG - Intergenic
981752739 4:148108423-148108445 ATGTCATTCTTTAGGTCAAAAGG - Intronic
982477347 4:155869766-155869788 ATTTTATTCTTAATCTCAGAAGG + Intronic
983300795 4:165923037-165923059 TTATAATTCTTTGGCTCAGAAGG - Intronic
983494277 4:168425807-168425829 TTCTGATTCTTTCCCTCAGTTGG + Intronic
985120691 4:186638510-186638532 ATCTGAGTTTTTAGTTCATAGGG - Intronic
986644785 5:9906276-9906298 TTCTGTTTCTTTATCTCAGTTGG + Intergenic
987617084 5:20290184-20290206 TTCTGATTCAGTAGGTCAGATGG - Intronic
989741406 5:44777410-44777432 ATTTTAGTCTTTAGCTCAGCTGG - Intergenic
990047474 5:51451132-51451154 GTCTGACTGTATAGCTCAGATGG + Intergenic
990338428 5:54798170-54798192 AGCTGATTCTTAAGTTCATATGG + Intergenic
990992467 5:61699376-61699398 ATCTGAGGCTTTAGCGGAGATGG - Intronic
992788152 5:80189401-80189423 ATTTGTGTCTTTGGCTCAGAGGG - Intronic
993058006 5:83004697-83004719 TTCTTATTCTTTATATCAGATGG + Intergenic
993550501 5:89267754-89267776 AACTGAGTTTTTAGCTAAGAAGG - Intergenic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
993846657 5:92953116-92953138 ACCTGATTCTTGAGCTTAGGTGG + Intergenic
997296088 5:132769420-132769442 ATCAGATCCTTGACCTCAGAGGG + Intronic
1000401602 5:160834391-160834413 ATCTGATTCTTATGCTCCTAGGG + Intronic
1001111871 5:168903456-168903478 ATCCCATTCTCTAGATCAGAGGG + Intronic
1005396864 6:25391437-25391459 ATCTGAGGCTCTATCTCAGAAGG - Intronic
1007684399 6:43656630-43656652 GTCTTATTCTTTAGCTCAACAGG - Exonic
1008836649 6:55840427-55840449 ACTTGATTCTTTATCTGAGAGGG + Intronic
1008996002 6:57659908-57659930 ATCTCAATCTTTATTTCAGAAGG + Intergenic
1009184532 6:60558685-60558707 ATCTCAATCTTTATTTCAGAAGG + Intergenic
1009321785 6:62300036-62300058 ATCTGTTTCTCTTGCTCAGGGGG - Intergenic
1011876577 6:91969856-91969878 ATCTGTTTCTATAGCACTGATGG + Intergenic
1014868361 6:126559651-126559673 AAGTGCTTCTTTAGCTCAGGGGG - Intergenic
1015121756 6:129708117-129708139 ATCTGATTCGTTAGCCCTTAAGG + Intronic
1015230188 6:130905958-130905980 ATCTGCTTCTTAAGTTCAGCAGG - Intronic
1018424466 6:163667893-163667915 ATCAGATGCTTTCTCTCAGATGG - Intergenic
1018762614 6:166904895-166904917 ACCTGATTCTGCAGCTCAGAGGG + Intronic
1019790615 7:3010431-3010453 ATCTGATTCTATAGCTTTGCAGG - Intronic
1020021136 7:4869819-4869841 ATCTGACTCTTTCGCAAAGATGG + Intronic
1022137809 7:27465941-27465963 ATCTTATTCTCTGCCTCAGAAGG - Intergenic
1024320835 7:48067644-48067666 ATCTGGTTCTTGATCTTAGAGGG - Intergenic
1024623188 7:51181332-51181354 AGCTAATTATTTAGCTCAGGCGG - Intronic
1028410118 7:90521521-90521543 ATGTTATTCTTTAACTGAGAAGG - Intronic
1028547391 7:92018826-92018848 ATATGACTCTGCAGCTCAGAAGG - Intronic
1029917702 7:104229364-104229386 ATCTAAGTGTTTAGCTCAAATGG - Intergenic
1032811640 7:135425174-135425196 ATCTGGTTCTTCATCACAGAAGG + Intronic
1033361623 7:140641830-140641852 ATCCTCATCTTTAGCTCAGAAGG + Intronic
1043533452 8:81175171-81175193 ATCTCAGTCCTCAGCTCAGAAGG + Intergenic
1043691550 8:83159656-83159678 ATCTGTTTCTGCAGCTCAGAGGG + Intergenic
1045020838 8:98043152-98043174 ATCTCATTCTGTCGCTCAGGCGG + Intronic
1045544346 8:103114758-103114780 ATCTGATTCTTCAGGCCAGAAGG - Intergenic
1045815934 8:106276073-106276095 ATCTGAATCCTGGGCTCAGATGG + Intronic
1045974962 8:108121973-108121995 ATATGCTCCTTTAGCTCAGAAGG + Intergenic
1046095789 8:109558974-109558996 ATCTGATCCTTTAGTAGAGATGG - Intronic
1051904571 9:22080388-22080410 CTCAGAATCTTTAGCTCAGAAGG - Intergenic
1053148271 9:35726737-35726759 ATGTGATTCTCTAACTCAAAGGG + Intronic
1054821681 9:69527869-69527891 ATCTGATTTTTTACCTTAAAGGG + Intronic
1056072428 9:83001599-83001621 ATCTTATTTTTCAGCTCTGAGGG - Intronic
1059000801 9:110346886-110346908 ATGTGATTCTATAGATAAGAGGG + Intergenic
1059090523 9:111352743-111352765 ATCTCATTCCTGAGCTTAGAGGG + Intergenic
1059881742 9:118697969-118697991 AACTGATTCTCAAGCTTAGATGG + Intergenic
1187119797 X:16393434-16393456 TTCTGATTTCTTAACTCAGAAGG - Intergenic
1187125555 X:16451299-16451321 CACTGATTCTTTAGCACAAATGG - Intergenic
1188543123 X:31271287-31271309 ATCTGAGTCTTGAGCTCAGAGGG + Intronic
1190843860 X:54172756-54172778 TTCTGATTCTGTAGGTCCGATGG + Intronic
1191028626 X:55942981-55943003 AGATGATTCTTCAGCTTAGATGG + Intergenic
1192705194 X:73522066-73522088 ATGTGTTTCTTTTGCTCTGAAGG - Intergenic
1193488856 X:82122097-82122119 ATCTTAAGCTTTAGCACAGATGG + Intergenic
1193745277 X:85271091-85271113 ATATGTTTCTTGAGTTCAGAAGG - Exonic
1194234683 X:91367592-91367614 ATCTGATGTCTTAGCTCAGAAGG - Intergenic
1194314797 X:92363723-92363745 ATCTTATTCCTGATCTCAGAGGG + Intronic
1195730867 X:107965631-107965653 ATCTGATTATTTCACTAAGAGGG + Intergenic
1200394147 X:155973458-155973480 ATCTGCTTCTTGTGCTCACAGGG + Intergenic
1200622850 Y:5475238-5475260 ATCTTATTCTTGATCTCAGAGGG + Intronic
1200973173 Y:9178099-9178121 AACTTATTCTTTACCTTAGAAGG + Intergenic
1201689875 Y:16751969-16751991 ATATACTCCTTTAGCTCAGAGGG + Intergenic
1202137906 Y:21686414-21686436 AACTTATTCTTTACCTTAGAAGG - Intergenic