ID: 972552192

View in Genome Browser
Species Human (GRCh38)
Location 4:40144182-40144204
Sequence CGGGCAGGCACCAACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972552192_972552202 17 Left 972552192 4:40144182-40144204 CCCACATGGTTGGTGCCTGCCCG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 972552202 4:40144222-40144244 CTTTCTGTCCACTGACATGCAGG 0: 1
1: 0
2: 4
3: 22
4: 180
972552192_972552198 -10 Left 972552192 4:40144182-40144204 CCCACATGGTTGGTGCCTGCCCG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 972552198 4:40144195-40144217 TGCCTGCCCGCATGGAGGGGAGG No data
972552192_972552203 18 Left 972552192 4:40144182-40144204 CCCACATGGTTGGTGCCTGCCCG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 972552203 4:40144223-40144245 TTTCTGTCCACTGACATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972552192 Original CRISPR CGGGCAGGCACCAACCATGT GGG (reversed) Intronic
900323321 1:2095589-2095611 CCGGCCGGCACCACCCATGCAGG - Intronic
900555848 1:3279883-3279905 CGGGCACCCACCACCAATGTGGG + Intronic
903003016 1:20279806-20279828 CGGGGAGGAACCACCCATGTGGG + Intergenic
903642774 1:24871172-24871194 CAGGCAGGCTCCACCCACGTGGG - Intergenic
909173360 1:72322500-72322522 AGTGCAGGCACCAGCCATGAGGG - Intergenic
919922942 1:202177159-202177181 CGGGCAGGCACCAGCGCCGTCGG + Intergenic
924898011 1:248363193-248363215 CTTTCAGGAACCAACCATGTGGG - Intergenic
1064317924 10:14275457-14275479 CAGATAGCCACCAACCATGTGGG - Intronic
1064632762 10:17333906-17333928 AGGACAGGGTCCAACCATGTTGG + Intronic
1064820097 10:19319663-19319685 CAAGCAGGCACCATCCATGAAGG - Intronic
1070634809 10:78116762-78116784 AGGGCAAGCATCAAGCATGTAGG - Intergenic
1072725083 10:97807661-97807683 GGGGCAGGACCCAACCATATGGG - Intergenic
1074360271 10:112820070-112820092 CTGGCAGGCACGAGCCAGGTGGG + Intergenic
1075737350 10:124672202-124672224 CGGTCAGGCACCAGCCGTGCTGG + Intronic
1077185292 11:1233052-1233074 CTGGCAGGCATCCACCACGTAGG - Exonic
1084688850 11:70713107-70713129 AGGGGAGGCACCAGCCCTGTCGG + Intronic
1086331992 11:85763396-85763418 AAGGCAAGCACCAACTATGTGGG - Intronic
1086717201 11:90076939-90076961 CAGGCTTTCACCAACCATGTTGG - Intergenic
1093798064 12:23337337-23337359 CTGGAAGGCACCACCCATGGTGG + Intergenic
1104715650 12:131014433-131014455 CGGGCCGGCACCAAGGCTGTTGG - Intronic
1118585012 14:67344296-67344318 CGGGAAGACACCAACAAAGTTGG - Intronic
1125345437 15:38714445-38714467 CTGGCAGGCACCCACACTGTAGG - Intergenic
1125417189 15:39466235-39466257 CGGGCAGGCATCAAAGAGGTGGG - Intergenic
1125782519 15:42282579-42282601 CAGGCAGGCACCAAGAGTGTTGG - Intronic
1142203136 16:88770565-88770587 CAGGCAGGCACCGCCCATGGCGG - Intronic
1146842627 17:36166359-36166381 CGGGAAGACACCTACCCTGTGGG - Exonic
1146854939 17:36254318-36254340 CGGGAAGACACCTACCCTGTGGG - Exonic
1146865681 17:36334058-36334080 CGGGAAGACACCTACCCTGTGGG + Exonic
1146870839 17:36378210-36378232 CGGGAAGACACCTACCCTGTGGG - Exonic
1146878198 17:36429292-36429314 CGGGAAGACACCTACCCTGTGGG - Exonic
1146882147 17:36450438-36450460 CGGGAAGACACCTACCCTGTGGG - Intergenic
1147068550 17:37934670-37934692 CGGGAAGACACCTACCCTGTGGG + Exonic
1147073723 17:37978834-37978856 CGGGAAGACACCTACCCTGTGGG - Intronic
1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG + Intronic
1147085244 17:38058372-38058394 CGGGAAGACACCTACCCTGTGGG - Exonic
1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG + Intergenic
1147101191 17:38182338-38182360 CGGGAAGACACCTACCCTGTGGG - Intergenic
1149845789 17:60008844-60008866 CGGGAAGACACCTACCCTGTGGG - Intergenic
1150084137 17:62265424-62265446 CGGGAAGACACCTACCCTGTGGG - Intergenic
1150492907 17:65586699-65586721 CTGGCAGGCACCTGACATGTGGG - Intronic
1152403195 17:80082051-80082073 GGGGCAGGGGCCTACCATGTTGG - Exonic
1160079589 18:75712638-75712660 CGGGCATGCAGCAGCCATTTTGG - Intergenic
1160823968 19:1071011-1071033 CGGGGTGGCACCGTCCATGTGGG - Intronic
1161138929 19:2636716-2636738 AGGGCAGGGGCCAACCATCTGGG + Intronic
1167459092 19:49615003-49615025 CAGTCAGGTACCAACCATGGGGG + Exonic
933301176 2:80543281-80543303 GGGGCAGGAACCAACGATGCAGG - Intronic
934476547 2:94597341-94597363 TGGGCAGGTATCAAGCATGTGGG - Intronic
937362129 2:121236769-121236791 AGGGCAGTCAGCCACCATGTGGG - Intronic
1169073576 20:2748768-2748790 CCAGCAGGCACCAACCAGGCTGG - Intronic
1176690098 21:9896201-9896223 TGGGCAGGCAAAATCCATGTTGG - Intergenic
1181045905 22:20214183-20214205 GGGGCAGGCAGGAACCATGAGGG + Intergenic
1183231672 22:36586178-36586200 GGGGCAGGCCCCATCCATCTTGG + Intronic
1184628253 22:45754889-45754911 TGGGCAGGCAGCCACCATGAAGG + Intronic
949874986 3:8620677-8620699 CGGAAAGTCACCAACCAAGTAGG + Intronic
960184074 3:114617214-114617236 CAGGCAGGGAACAATCATGTTGG - Intronic
968036425 3:195551889-195551911 TGGGCAGGCCCCAACCAAGCAGG + Intergenic
968528524 4:1077519-1077541 CTGGCAGGCAGCAGGCATGTCGG - Intronic
972552192 4:40144182-40144204 CGGGCAGGCACCAACCATGTGGG - Intronic
974147747 4:57967474-57967496 CGTGCAGGAGCCCACCATGTGGG - Intergenic
979473211 4:121125255-121125277 TGGGCAGGTACAAATCATGTTGG - Intergenic
980353512 4:131714135-131714157 TGGGCAGGCAAAATCCATGTTGG - Intergenic
983655454 4:170079334-170079356 TGGGCAGAGACCAACCATGTAGG + Intronic
996801623 5:127409754-127409776 CTGGCAGGCACTTCCCATGTTGG + Intronic
1001801583 5:174548965-174548987 GGGGCAGGCACAATCAATGTGGG + Intergenic
1005667470 6:28072823-28072845 CAGGCAGACACCTACCATTTAGG - Intergenic
1006502149 6:34465942-34465964 CGGGGAGGCAGCAACCAGTTTGG - Intergenic
1015018904 6:128448073-128448095 TGGCCAGCCACCAGCCATGTTGG + Intronic
1028456624 7:91044851-91044873 CAGGGAGGCTCCAGCCATGTGGG - Intronic
1029799654 7:102933244-102933266 CTCCCAGTCACCAACCATGTTGG - Intronic
1031752965 7:125600586-125600608 AGGCCAGGCACCAGCCCTGTTGG + Intergenic
1032078988 7:128849319-128849341 CAGGCAGGCACCTGCCATGCGGG - Exonic
1035542847 8:455281-455303 CAGGCAGGGACCAGCCAGGTTGG + Intronic
1037645029 8:20785260-20785282 CAGGCAGGGGCCAACCCTGTTGG + Intergenic
1043446779 8:80326875-80326897 CAGGCAGGCACCACCACTGTTGG - Intergenic
1044743642 8:95352036-95352058 CAAGCAGGTACCAGCCATGTAGG + Intergenic
1048674244 8:136759547-136759569 GGGGAAGACACCATCCATGTGGG + Intergenic
1051991815 9:23161319-23161341 AGAGCAGGCACCAGCCATGATGG - Intergenic
1052853487 9:33392557-33392579 TGGGCAGGTATCAAGCATGTGGG + Intronic
1053626825 9:39880746-39880768 TGGGCAGGCAAAATCCATGTTGG - Intergenic
1053681510 9:40488737-40488759 TGGGCAGGTATCAAGCATGTGGG + Intergenic
1053779164 9:41585274-41585296 TGGGCAGGCAAAATCCATGTTGG + Intergenic
1053931505 9:43117067-43117089 TGGGCAGGTATCAAGCATGTGGG + Intergenic
1054167123 9:61795515-61795537 TGGGCAGGCAAAATCCATGTTGG + Intergenic
1054217062 9:62369957-62369979 TGGGCAGGCAAAATCCATGTTGG + Intergenic
1054282203 9:63136197-63136219 TGGGCAGGTATCAAGCATGTGGG - Intergenic
1054294601 9:63324254-63324276 TGGGCAGGTATCAAGCATGTGGG + Intergenic
1054392623 9:64628741-64628763 TGGGCAGGTATCAAGCATGTGGG + Intergenic
1054427271 9:65133950-65133972 TGGGCAGGTATCAAGCATGTGGG + Intergenic
1054503105 9:65887590-65887612 TGGGCAGGTATCAAGCATGTGGG - Intronic
1054670424 9:67785383-67785405 TGGGCAGGCAAAATCCATGTTGG - Intergenic
1060849142 9:126860562-126860584 CGGGCAGGCGCCAACCCGGGTGG - Intergenic
1061809083 9:133152042-133152064 CGGGCAGGCACCCACCCACTTGG - Intergenic
1062668203 9:137689873-137689895 TGGGCAGGTGCCCACCATGTTGG + Intronic
1062707654 9:137954187-137954209 GGGGCTGGCACCCCCCATGTGGG + Intronic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic