ID: 972554354

View in Genome Browser
Species Human (GRCh38)
Location 4:40166226-40166248
Sequence GAAATTCTTCATGTGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972554354_972554360 20 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554360 4:40166269-40166291 TGAACAGCAGGCTATCTGGCGGG No data
972554354_972554358 16 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554358 4:40166265-40166287 AAACTGAACAGCAGGCTATCTGG No data
972554354_972554359 19 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554359 4:40166268-40166290 CTGAACAGCAGGCTATCTGGCGG No data
972554354_972554357 8 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554357 4:40166257-40166279 TCTGTAAGAAACTGAACAGCAGG No data
972554354_972554361 25 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554361 4:40166274-40166296 AGCAGGCTATCTGGCGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972554354 Original CRISPR GAAATTCTTCATGTGAAACA GGG (reversed) Intergenic