ID: 972554355

View in Genome Browser
Species Human (GRCh38)
Location 4:40166227-40166249
Sequence AGAAATTCTTCATGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972554355_972554357 7 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554357 4:40166257-40166279 TCTGTAAGAAACTGAACAGCAGG No data
972554355_972554358 15 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554358 4:40166265-40166287 AAACTGAACAGCAGGCTATCTGG No data
972554355_972554360 19 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554360 4:40166269-40166291 TGAACAGCAGGCTATCTGGCGGG No data
972554355_972554361 24 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554361 4:40166274-40166296 AGCAGGCTATCTGGCGGGATAGG No data
972554355_972554359 18 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554359 4:40166268-40166290 CTGAACAGCAGGCTATCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972554355 Original CRISPR AGAAATTCTTCATGTGAAAC AGG (reversed) Intergenic