ID: 972554360

View in Genome Browser
Species Human (GRCh38)
Location 4:40166269-40166291
Sequence TGAACAGCAGGCTATCTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972554354_972554360 20 Left 972554354 4:40166226-40166248 CCCTGTTTCACATGAAGAATTTC No data
Right 972554360 4:40166269-40166291 TGAACAGCAGGCTATCTGGCGGG No data
972554355_972554360 19 Left 972554355 4:40166227-40166249 CCTGTTTCACATGAAGAATTTCT No data
Right 972554360 4:40166269-40166291 TGAACAGCAGGCTATCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972554360 Original CRISPR TGAACAGCAGGCTATCTGGC GGG Intergenic